Raman spectroscopy is used to identify the biochemical differences between normal brain tissue (cerebellum and meninges) compared with tumor (glioblastoma, medulloblastoma, schwannoma and meningioma) through biochemical information obtained from the sample.

A total of 263 spectra were obtained from fragments of cerebellum normal (65), meninges normal (69), glioblastoma (28), schwannoma (8), medulloblastoma (19), and meningioma (74), which is collected using dispersive the Raman spectrometer ( 830 nm, near infrared power, output 350 mW, 20 s exposure time to obtain the spectrum), coupled to the Raman probe.

A model spectral based quadratic fit was developed to estimate the concentration of biochemistry of 16 biochemical compounds present in brain tissue, among them the most characterized the spectrum of brain tissue, such as linolenic acid, triolein, cholesterol, sphingomyelin, phosphatidylcholine, β-carotene, collagen, phenylalanine, DNA, glucose, and blood.

Of biochemical information, classification spectra in normal and tumor groups was performed according to the type of brain tumor and corresponding normal tissue. The classifications used in the model of discrimination is (a) the concentration of the biochemical constituents of the brain, through a linear discriminant analysis (LDA), and (b) the spectrum of the network, through discrimination by partial least squares (PLS-DA) regression.

The model obtained 93.3% accuracy with LDA discrimination between normal and tumor cerebellum groups separated according to the concentration of biochemical constituents and 94.1% in discrimination by PLS-DA using the whole spectrum. The results obtained showed that the Raman technique is a promising tool for distinguishing concentrations of biochemical compounds present in brain tissue, both normal and tumor. The concentration predicted by models of biochemical and all information contained in Raman spectra were both able to classify pathologic group.

Persistence biochemistry of prostate specific antigen after robot-assisted Laparoscopic Radical Prostatectomy: Tumor localization using PSMA PET / CT imaging

Since the introduction of radiolabeled prostate-specific membrane antigen (PSMA) positron emission tomography / computed tomography (PET / CT), the ability to visualize recurrent prostate cancer has increased substantially. However, PSMA radiolabeled diagnostic accuracy of PET / CT in patients with biochemical persistence (BCP; ie, continuously measured prostate-specific antigen (PSA) -values ​​after robot-assisted laparoscopic radical prostatectomy (RARP)) largely lacking.

Therefore, the aim of this study was to determine the role of PSMA (ie, 18F-DCFPyL or 68Ga-PSMA-11) PET / CT imaging in patients with BCP after RARP and to evaluate the site of disease are persistent on PSMA PET / CT. Methods: A total of 150 consecutive patients with BCP after undergoing RARP PSMA radiolabeled PET / CT imaging were retrospectively evaluated. BCP is defined as any first detectable serum PSA values ​​after RARP (≥0.1 ng / mL) for at least 6 weeks after surgery, the absence of an undetectable PSA values ​​after RARP.

A multivariable logistic regression analysis was performed to identify predictors for the detection of metastases outside the prostate fossa (≥miN1) on PSMA PET / CT. Results: A PSMA PET / CT was performed in the PSA-median value of 0.60 ng / mL (interquartile range (IQR) from 0.3 to 2.4) after a median period of 6 months (IQR 4-10) following RARP. In total, 101/150 patients (67%) had lesions with PSMA-expression PET / CT, which was 89/150 patients (59%) had lesions with increased expression of PSMA sites outside the prostatic fossa.

Fermentation optimization, purification and biochemical characterization of ι-carrageenase of marine bacteria Cellulophaga Baltica

Degrading marine bacterium ι-carrageenan, Cellulophaga Baltica, isolated from the surface of red algae filaments fucoides Vertebrates. ι-carrageenase maximum production is optimized by single factor experiment. The optimum fermentation conditions was 1.6 g / L furcellaran, 4 g / L of yeast extract as a carbon source, 5 g / L sea salt, and 48 hours of incubation at 20 ° C. Extracellular ι-carrageenase of culture supernatant purified by ultrafiltration , ammonium sulfate precipitation, and finally with anion exchange chromatography, showing 26 fold increase in specific activity compared to that in the crude enzyme.

According to the results of SDS-PAGE and HPLC-SEC, estimated molecular weight of 31 kDa purified enzyme. Purified enzyme showed maximum specific activity of 571 U / mg at 40 ° C and pH 7.5 to 8.0. It retains 73% of the total activity below 40 ° C and 90% of total activity at pH 7.2.

Especially, the enzyme is ι-carrageenase cold-adapted, which showed 33.4% of the maximum activity at 10 ° C. The enzyme is stimulated by Na +, K +, and NH4 +, while Ca 2+, Mg 2+, Fe 3+, sea salt and EDTA acts as an inhibitor of the enzyme.

Effect of Ramadan intermittent fasting on cognitive responses, physical and biochemical for heavy short-term exercise in young female elite handball players

This study aims to assess the effects of intermittent fasting Ramadan (RF) in response to cognitive, physical and biochemistry to exercise in young female elite handball players. Twelve athletes participated in three experimental sessions: one week before Ramadan (BR), in the first week of Ramadan (FWR) and during the last week of Ramadan (LWR).

Crossover studies carried out in Tunisia during the 2013 Ramadan which takes place from 9 July to 7 August. During each session, a battery test is performed as follows: Index Hooper, tests alertness (VT), Epworth sleepiness scale (ESS), five test jump (5-JT), modified agility T-test (MAT), the maximum stood ball speed test – throw (MSBVT) and Running-based Anaerobic Sprint (RAST) test. Ratings of perceived exertion (RPE) was recorded immediately after the RAST.

Blood samples were taken before and after exercise during each session. The results showed that the higher the ESS score for LWR of BR (p <0.05). In addition, MSBVT time decreased (p <0.05) for LWR, because it improved performance. Strength three final sprint of RAST decreased significantly only for LWR compared with BR (p <0.05). RAST fatigue index and higher RPE scores for LWR more than BR (p <0.05).

The results showed also measures hematology (blood cell, namely, red, hemoglobin, and hematocrit), plasma osmolarity and energetic markers are not affected by RF. Biomarkers higher muscle damage after RAST only for LWR compared with BR (p <0.01 for all). In conclusion, increased RF performance decline RAST ESS and associated with higher muscle damage and fatigue, especially on the LWR. This change can be attributed to the previous and circadian rhythm sleep disorders than malnutrition or dehydratation.


Rat Granzyme B (GZMB) ELISA Kit

EUR 508
  • Should the Rat Granzyme B (GZMB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Granzyme B (GZMB) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Granzyme B (GZMB) ELISA Kit

EUR 661
  • Should the Rat Granzyme B (GZMB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Granzyme B (GZMB) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Granzyme B (GZMB) ELISA Kit

RDR-GZMB-Hu-48Tests 48 Tests
EUR 500

Human Granzyme B (GZMB) ELISA Kit

RDR-GZMB-Hu-96Tests 96 Tests
EUR 692

Mouse Granzyme B (GZMB) ELISA Kit

RDR-GZMB-Mu-48Tests 48 Tests
EUR 511

Mouse Granzyme B (GZMB) ELISA Kit

RDR-GZMB-Mu-96Tests 96 Tests
EUR 709

Rat Granzyme B (GZMB) ELISA Kit

RDR-GZMB-Ra-48Tests 48 Tests
EUR 534

Rat Granzyme B (GZMB) ELISA Kit

RDR-GZMB-Ra-96Tests 96 Tests
EUR 742

Human Granzyme B (GZMB) ELISA Kit

RD-GZMB-Hu-48Tests 48 Tests
EUR 478

Human Granzyme B (GZMB) ELISA Kit

RD-GZMB-Hu-96Tests 96 Tests
EUR 662

Mouse Granzyme B (GZMB) ELISA Kit

RD-GZMB-Mu-48Tests 48 Tests
EUR 489

Mouse Granzyme B (GZMB) ELISA Kit

RD-GZMB-Mu-96Tests 96 Tests
EUR 677

Rat Granzyme B (GZMB) ELISA Kit

RD-GZMB-Ra-48Tests 48 Tests
EUR 511

Rat Granzyme B (GZMB) ELISA Kit

RD-GZMB-Ra-96Tests 96 Tests
EUR 709

GZMB antibody

70R-17668 50 ul
EUR 435
Description: Rabbit polyclonal GZMB antibody

GZMB Antibody

32711-100ul 100ul
EUR 252

GZMB Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

GZMB Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

GZMB Antibody

DF7012 200ul
EUR 304
Description: GZMB Antibody detects endogenous levels of total GZMB.

GZMB Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

GZMB Antibody

CSB-PA272248-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

GZMB Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

GZMB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:100-1:500

GZMB Antibody

ABD7012 100 ug
EUR 438

GZMB Conjugated Antibody

C32711 100ul
EUR 397

GZMB/GZMH Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GZMB/GZMH. Recognizes GZMB/GZMH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

GZMB / GZMH Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

GZMB Polyclonal Antibody

A55359 100 µg
EUR 570.55
Description: reagents widely cited

anti- GZMB antibody

FNab03737 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: granzyme B
  • Uniprot ID: P10144
  • Gene ID: 3002
  • Research Area: Cancer, Immunology, Metabolism
Description: Antibody raised against GZMB

Anti-GZMB antibody

PAab03737 100 ug
EUR 412

Anti-GZMB antibody

STJ26211 100 µl
EUR 277
Description: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein encoded by this gene is crucial for the rapid induction of target cell apoptosis by CTL in cell-mediated immune response.

Anti-GZMB Antibody

STJ501289 100 µg
EUR 476

Anti-GZMB Antibody

STJ501290 100 µg
EUR 476

Gzmb/ Rat Gzmb ELISA Kit

ELI-02162r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Granzyme B (GZMB) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Granzyme B (GZMB) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Granzyme B (GZMB) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Granzyme B (GZMB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody

abx139484-01mg 0.1 mg
EUR 411
  • Shipped within 5-12 working days.

Granzyme B (GZMB) Antibody

  • EUR 314.00
  • EUR 787.00
  • EUR 411.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Granzyme B (GZMB) Antibody

  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Granzyme B (GZMB) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • EUR 70.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • 5 ug
  • Shipped within 5-10 working days.

GZMB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GZMB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GZMB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Granzyme B (GZMB) Antibody

abx233737-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Granzyme B (GZMB) Antibody

abx332436-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-GZMB Antibody (Biotin)

STJ501291 100 µg
EUR 586

Anti-GZMB Antibody (FITC)

STJ501292 100 µg
EUR 586

Anti-GZMB Antibody (Biotin)

STJ501293 100 µg
EUR 586

Anti-GZMB Antibody (FITC)

STJ501294 100 µg
EUR 586

Human Granzyme B (GZMB) Antibody

32100-05111 150 ug
EUR 261

Anti-Granzyme B/Gzmb Antibody

A00353-1 100ug/vial
EUR 294

Granzyme B (GZMB) Antibody (PE)

abx201109-100tests 100 tests
EUR 592
  • Shipped within 2-3 weeks.

Granzyme B (GZMB) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody (Biotin)

abx413730-01mg 0.1 mg
EUR 592
  • Shipped within 1 week.

GZMB Polyclonal Antibody, HRP Conjugated

A55360 100 µg
EUR 570.55
Description: Ask the seller for details

GZMB Polyclonal Antibody, FITC Conjugated

A55361 100 µg
EUR 570.55
Description: The best epigenetics products

GZMB Polyclonal Antibody, Biotin Conjugated

A55362 100 µg
EUR 570.55
Description: kits suitable for this type of research

Anti-Granzyme B/GZMB Antibody

PA1738 100ug/vial
EUR 294

GZMB Blocking Peptide

DF7012-BP 1mg
EUR 195

GZMB cloning plasmid

CSB-CL010082HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 744
  • Sequence: atgcaaccaatcctgcttctgctggccttcctcctgctgcccagggcagatgcaggggagatcatcgggggacatgaggccaagccccactcccgcccctacatggcttatcttatgatctgggatcagaagtctctgaagaggtgcggtggcttcctgatacaagacgacttcgt
  • Show more
Description: A cloning plasmid for the GZMB gene.

GZMB Rabbit pAb

A2557-100ul 100 ul
EUR 308

GZMB Rabbit pAb

A2557-200ul 200 ul
EUR 459

GZMB Rabbit pAb

A2557-20ul 20 ul
EUR 183

GZMB Rabbit pAb

A2557-50ul 50 ul
EUR 223

Granzyme B (GZMB) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Thr16~Met244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB)

Human Granzyme B (GZMB)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 31.0 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Granzyme B(GZMB) expressed in E.coli

Human Granzyme B (GZMB)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 27.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Granzyme B(GZMB) expressed in Yeast

GZMB protein (His tag)

80R-4112 100 ug
EUR 327
Description: Recombinant Human GZMB protein (His tag)


ELA-E0600h 96 Tests
EUR 824


EF003968 96 Tests
EUR 689

Rat GZMB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GZMB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GZMB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Granzyme B (GZMB)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P10144
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.4kDa
  • Isoelectric Point: 9.7
Description: Recombinant Human Granzyme B expressed in: E.coli

Recombinant Granzyme B (GZMB)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04187
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 57.5kDa
  • Isoelectric Point: 8.9
Description: Recombinant Mouse Granzyme B expressed in: E.coli


PVT16346 2 ug
EUR 325

GZMB Recombinant Protein (Human)

RP014305 100 ug Ask for price

GZMB Recombinant Protein (Rat)

RP204089 100 ug Ask for price

GZMB Recombinant Protein (Mouse)

RP140612 100 ug Ask for price

Human Granzyme B (GZMB) Antibody (Biotin Conjugate)

32100-05121 150 ug
EUR 369

Polyclonal GZMB / Granzyme B Antibody (N-Terminus)

APR02530G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GZMB / Granzyme B (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GZMB / Granzyme B Antibody (aa10-59)

APR02925G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GZMB / Granzyme B (aa10-59). This antibody is tested and proven to work in the following applications:

Granzyme B (GZMB) Polyclonal Antibody (Human, Mouse)

  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Ile21~Tyr247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme B (GZMB)

Granzyme B (GZMB) Polyclonal Antibody (Mouse), APC

  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Thr16~Met244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB). This antibody is labeled with APC.

Granzyme B (GZMB) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Thr16~Met244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB). This antibody is labeled with Biotin.

Granzyme B (GZMB) Polyclonal Antibody (Mouse), Cy3

  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Thr16~Met244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB). This antibody is labeled with Cy3.

Granzyme B (GZMB) Polyclonal Antibody (Mouse), FITC

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Thr16~Met244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB). This antibody is labeled with FITC.

Granzyme B (GZMB) Polyclonal Antibody (Mouse), HRP

  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Thr16~Met244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB). This antibody is labeled with HRP.

Granzyme B (GZMB) Polyclonal Antibody (Mouse), PE

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Thr16~Met244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB). This antibody is labeled with PE.

Human Granzyme B (GZMB) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Granzyme B (GZMB) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Granzyme B (GZMB) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Gzmb ORF Vector (Rat) (pORF)

ORF068031 1.0 ug DNA
EUR 506

GZMB ORF Vector (Human) (pORF)

ORF004769 1.0 ug DNA
EUR 95

Gzmb ORF Vector (Mouse) (pORF)

ORF046872 1.0 ug DNA
EUR 506

GZMB ELISA Kit (Human) (OKAN04370)

OKAN04370 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the granzyme subfamily of proteins, part of the peptidase S1 family of serine proteases. The encoded preproprotein is secreted by natural killer (NK) cells and cytotoxic T lymphocytes (CTLs) and proteolytically processed to generate the active protease, which induces target cell apoptosis. This protein also processes cytokines and degrades extracellular matrix proteins, and these roles are implicated in chronic inflammation and wound healing. Expression of this gene may be elevated in human patients with cardiac fibrosis.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 30 pg/mL

GZMB ELISA Kit (Mouse) (OKBB00899)

OKBB00899 96 Wells
EUR 505
Description: Description of target: Granzyme B is a serine protease that in humans is encoded by the GZMB gene. Granzyme B is expressed by cytotoxic T lymphocytes (CTL) and natural killer (NK) cells. CTL and NK cells share the remarkable ability to recognize specific infected target cells. They are thought to protect their host by inducing apoptosis of cells that bear on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein encoded by this gene is crucial for the rapid induction of target cell apoptosis by CTL in cell-mediated immune response.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

GZMB ELISA Kit (Human) (OKCD06563)

OKCD06563 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the granzyme subfamily of proteins, part of the peptidase S1 family of serine proteases. The encoded preproprotein is secreted by natural killer (NK) cells and cytotoxic T lymphocytes (CTLs) and proteolytically processed to generate the active protease, which induces target cell apoptosis. This protein also processes cytokines and degrades extracellular matrix proteins, and these roles are implicated in chronic inflammation and wound healing. Expression of this gene may be elevated in human patients with cardiac fibrosis.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 2.7pg/mL

GZMB ELISA Kit (Mouse) (OKCD06564)

OKCD06564 96 Wells
EUR 779
Description: Description of target: This gene encodes a member of the granzyme subfamily of proteins, part of the peptidase S1 family of serine proteases. The encoded preproprotein is secreted by natural killer (NK) cells and cytotoxic T lymphocytes (CTLs) and proteolytically processed to generate the active protease, which induces target cell apoptosis. This protein also processes cytokines and degrades extracellular matrix proteins, and these roles are implicated in chronic inflammation and wound healing. Mice lacking a functional copy of this gene exhibit impaired immune cell-mediated cytolysis.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.4pg/mL

GZMB ELISA Kit (Rat) (OKCD06565)

OKCD06565 96 Wells
EUR 818
Description: Description of target: This enzyme is necessary for target cell lysis in cell-mediated immune responses. It cleaves after Asp. Seems to be linked to an activation cascade of caspases (aspartate-specific cysteine proteases) responsible for apoptosis execution. Cleaves caspase-3, -7, -9 and 10 to give rise to active enzymes mediating apoptosis.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 6.3pg/mL

GZMB ELISA Kit (Rat) (OKEH03163)

OKEH03163 96 Wells
EUR 662
Description: Description of target: This enzyme is necessary for target cell lysis in cell-mediated immune responses. It cleaves after Asp. Seems to be linked to an activation cascade of caspases (aspartate-specific cysteine proteases) responsible for apoptosis execution. Cleaves caspase-3, -7, -9 and 10 to give rise to active enzymes mediating apoptosis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.86 pg/mL

GZMB ELISA Kit (Mouse) (OKEH04356)

OKEH04356 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the granzyme subfamily of proteins, part of the peptidase S1 family of serine proteases. The encoded preproprotein is secreted by natural killer (NK) cells and cytotoxic T lymphocytes (CTLs) and proteolytically processed to generate the active protease, which induces target cell apoptosis. This protein also processes cytokines and degrades extracellular matrix proteins, and these roles are implicated in chronic inflammation and wound healing. Mice lacking a functional copy of this gene exhibit impaired immune cell-mediated cytolysis. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.84 pg/mL

Human Granzyme B (GZMB) AssayLite Antibody (FITC Conjugate)

32100-05141 150 ug
EUR 428

Human Granzyme B (GZMB) AssayLite Antibody (RPE Conjugate)

32100-05151 150 ug
EUR 428

Human Granzyme B (GZMB) AssayLite Antibody (APC Conjugate)

32100-05161 150 ug
EUR 428

Human Granzyme B (GZMB) AssayLite Antibody (PerCP Conjugate)

32100-05171 150 ug
EUR 471

Granzyme B (GZMB) Polyclonal Antibody (Human, Mouse), APC

  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Ile21~Tyr247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme B (GZMB). This antibody is labeled with APC.

Granzyme B (GZMB) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Ile21~Tyr247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme B (GZMB). This antibody is labeled with Biotin.

Granzyme B (GZMB) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Ile21~Tyr247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme B (GZMB). This antibody is labeled with Cy3.

Granzyme B (GZMB) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Ile21~Tyr247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme B (GZMB). This antibody is labeled with FITC.

Granzyme B (GZMB) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Ile21~Tyr247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme B (GZMB). This antibody is labeled with HRP.

Granzyme B (GZMB) Polyclonal Antibody (Human, Mouse), PE

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Ile21~Tyr247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme B (GZMB). This antibody is labeled with PE.

Granzyme B (GZMB) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GZMB (Thr16~Met244)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB). This antibody is labeled with APC-Cy7.

Rat Gzmb/ Granzyme B ELISA Kit

E0432Ra 1 Kit
EUR 571

Human Granzyme B (GzmB) CLIA Kit

abx197068-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Granzyme B (GZMB) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Granzyme B (GZMB) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Granzyme B (GZMB) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Granzyme B (GZMB) ELISA Kit

abx254775-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Granzyme B (GZMB) ELISA Kit

abx256311-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Granzyme B (GZMB) ELISA Kit

abx250859-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human GZMB/ Granzyme B ELISA Kit

E1080Hu 1 Kit
EUR 571

Human GzmB(Granzyme B) ELISA Kit

EH0157 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: P10144
  • Alias: GzmB(Granzyme B)/Gzmb/CSPB/CTLA-1/CTSGL1/Fragmentin-2/Granzyme-2/GRB/GrzB/GZMB/HLP/SECT/Granzyme B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Granzyme B, GZMB ELISA KIT

ELI-02160h 96 Tests
EUR 824

Human granzyme B (GZMB) ELISA Kit

CSB-E08718h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granzyme B (GZMB) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human granzyme B (GZMB) ELISA Kit

  • EUR 574.00
  • EUR 4013.00
  • EUR 2138.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human granzyme B (GZMB) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse granzyme B (GZMB) ELISA Kit

CSB-E08720m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse granzyme B (GZMB) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse granzyme B (GZMB) ELISA Kit

  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse granzyme B (GZMB) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig Granzyme B (GZMB) ELISA Kit

abx361654-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Granzyme B (GZMB) ELISA Kit

abx362534-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Granzyme B (GZMB) ELISA Kit

abx353359-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.