Use of Raman spectroscopy to evaluate the biochemical composition of normal and tumoral human brain tissues for diagnosis

Raman spectroscopy is used to identify the biochemical differences between normal brain tissue (cerebellum and meninges) compared with tumor (glioblastoma, medulloblastoma, schwannoma and meningioma) through biochemical information obtained from the sample.

A total of 263 spectra were obtained from fragments of cerebellum normal (65), meninges normal (69), glioblastoma (28), schwannoma (8), medulloblastoma (19), and meningioma (74), which is collected using dispersive the Raman spectrometer ( 830 nm, near infrared power, output 350 mW, 20 s exposure time to obtain the spectrum), coupled to the Raman probe.

A model spectral based quadratic fit was developed to estimate the concentration of biochemistry of 16 biochemical compounds present in brain tissue, among them the most characterized the spectrum of brain tissue, such as linolenic acid, triolein, cholesterol, sphingomyelin, phosphatidylcholine, β-carotene, collagen, phenylalanine, DNA, glucose, and blood.

Of biochemical information, classification spectra in normal and tumor groups was performed according to the type of brain tumor and corresponding normal tissue. The classifications used in the model of discrimination is (a) the concentration of the biochemical constituents of the brain, through a linear discriminant analysis (LDA), and (b) the spectrum of the network, through discrimination by partial least squares (PLS-DA) regression.

The model obtained 93.3% accuracy with LDA discrimination between normal and tumor cerebellum groups separated according to the concentration of biochemical constituents and 94.1% in discrimination by PLS-DA using the whole spectrum. The results obtained showed that the Raman technique is a promising tool for distinguishing concentrations of biochemical compounds present in brain tissue, both normal and tumor. The concentration predicted by models of biochemical and all information contained in Raman spectra were both able to classify pathologic group.

Persistence biochemistry of prostate specific antigen after robot-assisted Laparoscopic Radical Prostatectomy: Tumor localization using PSMA PET / CT imaging

Since the introduction of radiolabeled prostate-specific membrane antigen (PSMA) positron emission tomography / computed tomography (PET / CT), the ability to visualize recurrent prostate cancer has increased substantially. However, PSMA radiolabeled diagnostic accuracy of PET / CT in patients with biochemical persistence (BCP; ie, continuously measured prostate-specific antigen (PSA) -values ​​after robot-assisted laparoscopic radical prostatectomy (RARP)) largely lacking.

Therefore, the aim of this study was to determine the role of PSMA (ie, 18F-DCFPyL or 68Ga-PSMA-11) PET / CT imaging in patients with BCP after RARP and to evaluate the site of disease are persistent on PSMA PET / CT. Methods: A total of 150 consecutive patients with BCP after undergoing RARP PSMA radiolabeled PET / CT imaging were retrospectively evaluated. BCP is defined as any first detectable serum PSA values ​​after RARP (≥0.1 ng / mL) for at least 6 weeks after surgery, the absence of an undetectable PSA values ​​after RARP.

A multivariable logistic regression analysis was performed to identify predictors for the detection of metastases outside the prostate fossa (≥miN1) on PSMA PET / CT. Results: A PSMA PET / CT was performed in the PSA-median value of 0.60 ng / mL (interquartile range (IQR) from 0.3 to 2.4) after a median period of 6 months (IQR 4-10) following RARP. In total, 101/150 patients (67%) had lesions with PSMA-expression PET / CT, which was 89/150 patients (59%) had lesions with increased expression of PSMA sites outside the prostatic fossa.

Fermentation optimization, purification and biochemical characterization of ι-carrageenase of marine bacteria Cellulophaga Baltica

Degrading marine bacterium ι-carrageenan, Cellulophaga Baltica, isolated from the surface of red algae filaments fucoides Vertebrates. ι-carrageenase maximum production is optimized by single factor experiment. The optimum fermentation conditions was 1.6 g / L furcellaran, 4 g / L of yeast extract as a carbon source, 5 g / L sea salt, and 48 hours of incubation at 20 ° C. Extracellular ι-carrageenase of culture supernatant purified by ultrafiltration , ammonium sulfate precipitation, and finally with anion exchange chromatography, showing 26 fold increase in specific activity compared to that in the crude enzyme.

According to the results of SDS-PAGE and HPLC-SEC, estimated molecular weight of 31 kDa purified enzyme. Purified enzyme showed maximum specific activity of 571 U / mg at 40 ° C and pH 7.5 to 8.0. It retains 73% of the total activity below 40 ° C and 90% of total activity at pH 7.2.

Especially, the enzyme is ι-carrageenase cold-adapted, which showed 33.4% of the maximum activity at 10 ° C. The enzyme is stimulated by Na +, K +, and NH4 +, while Ca 2+, Mg 2+, Fe 3+, sea salt and EDTA acts as an inhibitor of the enzyme.

Effect of Ramadan intermittent fasting on cognitive responses, physical and biochemical for heavy short-term exercise in young female elite handball players

This study aims to assess the effects of intermittent fasting Ramadan (RF) in response to cognitive, physical and biochemistry to exercise in young female elite handball players. Twelve athletes participated in three experimental sessions: one week before Ramadan (BR), in the first week of Ramadan (FWR) and during the last week of Ramadan (LWR).

Crossover studies carried out in Tunisia during the 2013 Ramadan which takes place from 9 July to 7 August. During each session, a battery test is performed as follows: Index Hooper, tests alertness (VT), Epworth sleepiness scale (ESS), five test jump (5-JT), modified agility T-test (MAT), the maximum stood ball speed test – throw (MSBVT) and Running-based Anaerobic Sprint (RAST) test. Ratings of perceived exertion (RPE) was recorded immediately after the RAST.

Blood samples were taken before and after exercise during each session. The results showed that the higher the ESS score for LWR of BR (p <0.05). In addition, MSBVT time decreased (p <0.05) for LWR, because it improved performance. Strength three final sprint of RAST decreased significantly only for LWR compared with BR (p <0.05). RAST fatigue index and higher RPE scores for LWR more than BR (p <0.05).

The results showed also measures hematology (blood cell, namely, red, hemoglobin, and hematocrit), plasma osmolarity and energetic markers are not affected by RF. Biomarkers higher muscle damage after RAST only for LWR compared with BR (p <0.01 for all). In conclusion, increased RF performance decline RAST ESS and associated with higher muscle damage and fatigue, especially on the LWR. This change can be attributed to the previous and circadian rhythm sleep disorders than malnutrition or dehydratation.

 

Rat Granzyme B (GZMB) ELISA Kit
DLR-GZMB-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Granzyme B (GZMB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Granzyme B (GZMB) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Granzyme B (GZMB) ELISA Kit
DLR-GZMB-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Granzyme B (GZMB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Granzyme B (GZMB) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Granzyme B (GZMB) ELISA Kit
RD-GZMB-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Granzyme B (GZMB) ELISA Kit
RD-GZMB-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Mouse Granzyme B (GZMB) ELISA Kit
RD-GZMB-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Granzyme B (GZMB) ELISA Kit
RD-GZMB-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Rat Granzyme B (GZMB) ELISA Kit
RD-GZMB-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Granzyme B (GZMB) ELISA Kit
RD-GZMB-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Human Granzyme B (GZMB) ELISA Kit
RDR-GZMB-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Granzyme B (GZMB) ELISA Kit
RDR-GZMB-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Granzyme B (GZMB) ELISA Kit
RDR-GZMB-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Granzyme B (GZMB) ELISA Kit
RDR-GZMB-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Granzyme B (GZMB) ELISA Kit
RDR-GZMB-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Granzyme B (GZMB) ELISA Kit
RDR-GZMB-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

GZMB Antibody
ABD7012	Lifescience Market	100 ug	EUR 438

GZMB Antibody
32711-100ul	SAB	100ul	EUR 252

GZMB antibody
70R-17668	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GZMB antibody

GZMB Antibody
DF7012	Affbiotech	200ul	EUR 304
Description: GZMB Antibody detects endogenous levels of total GZMB.

GZMB Antibody
1-CSB-PA986806	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

GZMB Antibody
CSB-PA272248-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

GZMB Antibody
CSB-PA272248-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

GZMB Antibody
1-CSB-PA010082GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

GZMB Antibody
1-CSB-PA010082LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:100-1:500

GZMB Antibody
1-CSB-PA108047	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

GZMB Conjugated Antibody
C32711	SAB	100ul	EUR 397

anti- GZMB antibody
FNab03737	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:2000 IHC: 1:50-1:500 IF: 1:50-1:500 Immunogen: granzyme B Uniprot ID: P10144 Gene ID: 3002 Research Area: Cancer, Immunology, Metabolism
Description: Antibody raised against GZMB

GZMB / GZMH Antibody
20-abx329145	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

GZMB Polyclonal Antibody
A55359	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

GZMB/GZMH Antibody
1-CSB-PA009072	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GZMB/GZMH. Recognizes GZMB/GZMH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

Anti-GZMB antibody
PAab03737	Lifescience Market	100 ug	EUR 412

Anti-GZMB Antibody
STJ501289	St John's Laboratory	100 µg	EUR 476

Anti-GZMB Antibody
STJ501290	St John's Laboratory	100 µg	EUR 476

Anti-GZMB antibody
STJ26211	St John's Laboratory	100 µl	EUR 277
Description: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein encoded by this gene is crucial for the rapid induction of target cell apoptosis by CTL in cell-mediated immune response.

Gzmb/ Rat Gzmb ELISA Kit
ELI-02162r	Lifescience Market	96 Tests	EUR 886

GZMB siRNA
20-abx902389	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GZMB siRNA
20-abx918984	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GZMB siRNA
20-abx918985	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody
20-abx112844	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody
20-abx128920	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Granzyme B (GZMB) Antibody
20-abx109837	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody
20-abx001994	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody
abx139484-01mg	Abbexa	0.1 mg	EUR 411
Shipped within 5-12 working days.

Granzyme B (GZMB) Antibody
20-abx100561	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Granzyme B (GZMB) Antibody
20-abx013099	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00 EUR 70.00	100 ug 10 ug 200 ug 300 µg 5 ug
Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody
20-abx172667	Abbexa	EUR 314.00 EUR 787.00 EUR 411.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-12 working days.

Granzyme B (GZMB) Antibody
20-abx172668	Abbexa	EUR 843.00 EUR 439.00	1 mg 200 ug
Please enquire.

Granzyme B (GZMB) Antibody
20-abx176702	Abbexa	EUR 1135.00 EUR 551.00	1 mg 200 ug
Please enquire.

Granzyme B (GZMB) Antibody
20-abx176703	Abbexa	EUR 1177.00 EUR 578.00	1 mg 200 ug
Please enquire.

Granzyme B (GZMB) Antibody
abx332436-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody
abx233737-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Granzyme B (GZMB) Antibody
20-abx210840	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody
20-abx225208	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody
20-abx210520	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

GZMB Antibody, HRP conjugated
1-CSB-PA010082LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GZMB Antibody, FITC conjugated
1-CSB-PA010082LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GZMB Antibody, Biotin conjugated
1-CSB-PA010082LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GZMB. Recognizes GZMB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-GZMB Antibody (Biotin)
STJ501291	St John's Laboratory	100 µg	EUR 586

Anti-GZMB Antibody (FITC)
STJ501292	St John's Laboratory	100 µg	EUR 586

Anti-GZMB Antibody (Biotin)
STJ501293	St John's Laboratory	100 µg	EUR 586

Anti-GZMB Antibody (FITC)
STJ501294	St John's Laboratory	100 µg	EUR 586

Granzyme B (GZMB) Antibody (HRP)
20-abx108314	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody (Biotin)
20-abx105476	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody (FITC)
20-abx106894	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Granzyme B (GZMB) Antibody (Biotin)
abx413730-01mg	Abbexa	0.1 mg	EUR 592
Shipped within 1 week.

Granzyme B (GZMB) Antibody (PE)
abx201109-100tests	Abbexa	100 tests	EUR 592
Shipped within 2-3 weeks.

Anti-Granzyme B/Gzmb Antibody
A00353-1	BosterBio	100ug/vial	EUR 294

GZMB Polyclonal Antibody, HRP Conjugated
A55360	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

GZMB Polyclonal Antibody, FITC Conjugated
A55361	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

GZMB Polyclonal Antibody, Biotin Conjugated
A55362	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Human Granzyme B (GZMB) Antibody
32100-05111	AssayPro	150 ug	EUR 261

Anti-Granzyme B/GZMB Antibody
PA1738	BosterBio	100ug/vial	EUR 294

GZMB cloning plasmid
CSB-CL010082HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 744 Sequence: atgcaaccaatcctgcttctgctggccttcctcctgctgcccagggcagatgcaggggagatcatcgggggacatgaggccaagccccactcccgcccctacatggcttatcttatgatctgggatcagaagtctctgaagaggtgcggtggcttcctgatacaagacgacttcgt Show more
Description: A cloning plasmid for the GZMB gene.

GZMB Rabbit pAb
A2557-100ul	Abclonal	100 ul	EUR 308

GZMB Rabbit pAb
A2557-200ul	Abclonal	200 ul	EUR 459

GZMB Rabbit pAb
A2557-20ul	Abclonal	20 ul	EUR 183

GZMB Rabbit pAb
A2557-50ul	Abclonal	50 ul	EUR 223

GZMB Blocking Peptide
DF7012-BP	Affbiotech	1mg	EUR 195

Granzyme B (GZMB) Polyclonal Antibody (Mouse)
4-PAA600Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Thr16~Met244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB)

Rat GZMB shRNA Plasmid
20-abx987795	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GZMB ELISA Kit
ELA-E0600h	Lifescience Market	96 Tests	EUR 824

GzmB ELISA KIT|Human
EF003968	Lifescience Market	96 Tests	EUR 689

GZMB protein (His tag)
80R-4112	Fitzgerald	100 ug	EUR 327
Description: Recombinant Human GZMB protein (His tag)

Mouse GZMB shRNA Plasmid
20-abx970718	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GZMB shRNA Plasmid
20-abx952037	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Granzyme B (GZMB)
1-CSB-YP010082HU	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 27.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Granzyme B(GZMB) expressed in Yeast

Human Granzyme B (GZMB)
1-CSB-EP010082HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 31.0 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Granzyme B(GZMB) expressed in E.coli

Recombinant Granzyme B (GZMB)
4-RPA600Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P10144 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.4kDa Isoelectric Point: 9.7
Description: Recombinant Human Granzyme B expressed in: E.coli

Recombinant Granzyme B (GZMB)
4-RPA600Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04187 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 57.5kDa Isoelectric Point: 8.9
Description: Recombinant Mouse Granzyme B expressed in: E.coli

GZMB Recombinant Protein (Human)
RP014305	ABM	100 ug	Ask for price

pCMV-SPORT6-GZMB Plasmid
PVT16346	Lifescience Market	2 ug	EUR 325

GZMB Recombinant Protein (Rat)
RP204089	ABM	100 ug	Ask for price

GZMB Recombinant Protein (Mouse)
RP140612	ABM	100 ug	Ask for price

Polyclonal GZMB / Granzyme B Antibody (N-Terminus)
APR02530G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GZMB / Granzyme B (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GZMB / Granzyme B Antibody (aa10-59)
APR02925G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GZMB / Granzyme B (aa10-59). This antibody is tested and proven to work in the following applications:

Human Granzyme B (GZMB) Antibody (Biotin Conjugate)
32100-05121	AssayPro	150 ug	EUR 369

Granzyme B (GZMB) Polyclonal Antibody (Human, Mouse)
4-PAA600Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Ile21~Tyr247) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme B (GZMB)

Granzyme B (GZMB) Polyclonal Antibody (Mouse), APC
4-PAA600Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Thr16~Met244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB). This antibody is labeled with APC.

Granzyme B (GZMB) Polyclonal Antibody (Mouse), Biotinylated
4-PAA600Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Thr16~Met244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB). This antibody is labeled with Biotin.

Granzyme B (GZMB) Polyclonal Antibody (Mouse), Cy3
4-PAA600Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Thr16~Met244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB). This antibody is labeled with Cy3.

Granzyme B (GZMB) Polyclonal Antibody (Mouse), FITC
4-PAA600Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Thr16~Met244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB). This antibody is labeled with FITC.

Granzyme B (GZMB) Polyclonal Antibody (Mouse), HRP
4-PAA600Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Thr16~Met244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB). This antibody is labeled with HRP.

Granzyme B (GZMB) Polyclonal Antibody (Mouse), PE
4-PAA600Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Thr16~Met244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB). This antibody is labeled with PE.

Rat Granzyme B (GZMB) Protein
20-abx653633	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Granzyme B (GZMB) Protein
20-abx066910	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Granzyme B (GZMB) Protein
20-abx166567	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

GZMB ORF Vector (Human) (pORF)
ORF004769	ABM	1.0 ug DNA	EUR 95

Gzmb ORF Vector (Rat) (pORF)
ORF068031	ABM	1.0 ug DNA	EUR 506

Gzmb ORF Vector (Mouse) (pORF)
ORF046872	ABM	1.0 ug DNA	EUR 506

GZMB ELISA Kit (Human) (OKAN04370)
OKAN04370	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the granzyme subfamily of proteins, part of the peptidase S1 family of serine proteases. The encoded preproprotein is secreted by natural killer (NK) cells and cytotoxic T lymphocytes (CTLs) and proteolytically processed to generate the active protease, which induces target cell apoptosis. This protein also processes cytokines and degrades extracellular matrix proteins, and these roles are implicated in chronic inflammation and wound healing. Expression of this gene may be elevated in human patients with cardiac fibrosis.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 30 pg/mL

GZMB ELISA Kit (Human) (OKCD06563)
OKCD06563	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a member of the granzyme subfamily of proteins, part of the peptidase S1 family of serine proteases. The encoded preproprotein is secreted by natural killer (NK) cells and cytotoxic T lymphocytes (CTLs) and proteolytically processed to generate the active protease, which induces target cell apoptosis. This protein also processes cytokines and degrades extracellular matrix proteins, and these roles are implicated in chronic inflammation and wound healing. Expression of this gene may be elevated in human patients with cardiac fibrosis.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 2.7pg/mL

GZMB ELISA Kit (Mouse) (OKCD06564)
OKCD06564	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: This gene encodes a member of the granzyme subfamily of proteins, part of the peptidase S1 family of serine proteases. The encoded preproprotein is secreted by natural killer (NK) cells and cytotoxic T lymphocytes (CTLs) and proteolytically processed to generate the active protease, which induces target cell apoptosis. This protein also processes cytokines and degrades extracellular matrix proteins, and these roles are implicated in chronic inflammation and wound healing. Mice lacking a functional copy of this gene exhibit impaired immune cell-mediated cytolysis.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.4pg/mL

GZMB ELISA Kit (Rat) (OKCD06565)
OKCD06565	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: This enzyme is necessary for target cell lysis in cell-mediated immune responses. It cleaves after Asp. Seems to be linked to an activation cascade of caspases (aspartate-specific cysteine proteases) responsible for apoptosis execution. Cleaves caspase-3, -7, -9 and 10 to give rise to active enzymes mediating apoptosis.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 6.3pg/mL

GZMB ELISA Kit (Rat) (OKEH03163)
OKEH03163	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This enzyme is necessary for target cell lysis in cell-mediated immune responses. It cleaves after Asp. Seems to be linked to an activation cascade of caspases (aspartate-specific cysteine proteases) responsible for apoptosis execution. Cleaves caspase-3, -7, -9 and 10 to give rise to active enzymes mediating apoptosis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.86 pg/mL

GZMB ELISA Kit (Mouse) (OKEH04356)
OKEH04356	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a member of the granzyme subfamily of proteins, part of the peptidase S1 family of serine proteases. The encoded preproprotein is secreted by natural killer (NK) cells and cytotoxic T lymphocytes (CTLs) and proteolytically processed to generate the active protease, which induces target cell apoptosis. This protein also processes cytokines and degrades extracellular matrix proteins, and these roles are implicated in chronic inflammation and wound healing. Mice lacking a functional copy of this gene exhibit impaired immune cell-mediated cytolysis. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.84 pg/mL

GZMB ELISA Kit (Mouse) (OKBB00899)
OKBB00899	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Granzyme B is a serine protease that in humans is encoded by the GZMB gene. Granzyme B is expressed by cytotoxic T lymphocytes (CTL) and natural killer (NK) cells. CTL and NK cells share the remarkable ability to recognize specific infected target cells. They are thought to protect their host by inducing apoptosis of cells that bear on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein encoded by this gene is crucial for the rapid induction of target cell apoptosis by CTL in cell-mediated immune response.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Human Granzyme B (GZMB) AssayLite Antibody (FITC Conjugate)
32100-05141	AssayPro	150 ug	EUR 428

Human Granzyme B (GZMB) AssayLite Antibody (RPE Conjugate)
32100-05151	AssayPro	150 ug	EUR 428

Human Granzyme B (GZMB) AssayLite Antibody (APC Conjugate)
32100-05161	AssayPro	150 ug	EUR 428

Human Granzyme B (GZMB) AssayLite Antibody (PerCP Conjugate)
32100-05171	AssayPro	150 ug	EUR 471

Granzyme B (GZMB) Polyclonal Antibody (Human, Mouse), APC
4-PAA600Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Ile21~Tyr247) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme B (GZMB). This antibody is labeled with APC.

Granzyme B (GZMB) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAA600Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Ile21~Tyr247) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme B (GZMB). This antibody is labeled with Biotin.

Granzyme B (GZMB) Polyclonal Antibody (Human, Mouse), Cy3
4-PAA600Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Ile21~Tyr247) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme B (GZMB). This antibody is labeled with Cy3.

Granzyme B (GZMB) Polyclonal Antibody (Human, Mouse), FITC
4-PAA600Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Ile21~Tyr247) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme B (GZMB). This antibody is labeled with FITC.

Granzyme B (GZMB) Polyclonal Antibody (Human, Mouse), HRP
4-PAA600Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Ile21~Tyr247) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme B (GZMB). This antibody is labeled with HRP.

Granzyme B (GZMB) Polyclonal Antibody (Human, Mouse), PE
4-PAA600Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Ile21~Tyr247) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Granzyme B (GZMB). This antibody is labeled with PE.

Granzyme B (GZMB) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA600Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GZMB (Thr16~Met244) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Granzyme B (GZMB). This antibody is labeled with APC-Cy7.

Pig Granzyme B (GZMB) ELISA Kit
abx361654-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Granzyme B (GZMB) ELISA Kit
abx362534-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Granzyme B (GZMB) ELISA Kit
abx576135-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Rat Gzmb/ Granzyme B ELISA Kit
E0432Ra	Sunlong	1 Kit	EUR 571

Human GZMB/ Granzyme B ELISA Kit
E1080Hu	Sunlong	1 Kit	EUR 571

Human GzmB(Granzyme B) ELISA Kit
EH0157	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml Uniprot ID: P10144 Alias: GzmB(Granzyme B)/Gzmb/CSPB/CTLA-1/CTSGL1/Fragmentin-2/Granzyme-2/GRB/GrzB/GZMB/HLP/SECT/Granzyme B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Granzyme B, GZMB ELISA KIT
ELI-02160h	Lifescience Market	96 Tests	EUR 824

Rat Gzmb(Granzyme B) ELISA Kit
ER0333	FN Test	96T	EUR 567.6
Detection range: 15.6-1000 pg/ml Uniprot ID: P18291 Alias: Gzmb/CSPB/CTLA-1/CTSGL1/Fragmentin-2/Granzyme-2/GRB/GrzB/GZMB/HLP/SECT/Granzyme B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375pg/ml

GZMB sgRNA CRISPR Lentivector set (Human)
K0923901	ABM	3 x 1.0 ug	EUR 339

Rat Granzyme B (GZMB) ELISA Kit
20-abx155605	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Granzyme B (GZMB) ELISA Kit
20-abx154108	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Granzyme B (GZMB) ELISA Kit
20-abx151730	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Monkey Granzyme B (GZMB) ELISA Kit
abx353359-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Granzyme B (GZMB) ELISA Kit
abx364735-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Chicken Granzyme B (GZMB) ELISA Kit
abx356226-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Granzyme B (GZMB) CLIA Kit
20-abx491737	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Granzyme B (GZMB) CLIA Kit
20-abx491738	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Granzyme B (GZMB) CLIA Kit
20-abx491739	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.