Effect of flaxseed oil on biochemical parameters, hormonal indexes and stereological changes in ovariectomized rats

Is the ovariectomized rat preclinical model widely used to study the menopause and its complications. In this study, the therapeutic effects of flaxseed oil in ovariectomized adult rats were investigated. Our results suggest that biochemical parameters including levels of calcium, estrogen and progesterone increased 8 weeks after ovariectomy in rats. Also, the amount of alkaline phosphatase decreased significantly after 8 weeks compared to the OVX rats.

Healing potential of flaxseed oil is proven by restoring the affected tissues and prevent the unpleasant symptoms of the mice were ovariectomized. The biological effects of flaxseed oil may be due to the high amount of fatty acids, phytoestrogens, and various antioxidants. The results showed that flaxseed oil can mimic the action of estrogen and may be a potential treatment for hormone replacement therapy (HRT).

biochemical parameters and pathogenesis of SARS-CoV-2 infection in the vital organs: COVID-19 outbreak in Iran

With the emergence of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) outbreaks, humans would witness the first huge threat in the new millennium. Unexpectedly, the coronavirus disease in 2019 (COVID-19) spread the world leads to the death toll continues to rise. vital organs SARS-CoV-2 perturbs infection makes the body function patients of all ages are susceptible to this disease.

However, individuals develop critical illness with poor outcomes are mostly elderly people and people who have comorbid conditions that constitute the majority of COVID 19 fatalities. The COVID 19th most complications involving the respiratory system, kidneys and cardiovascular, and in severe cases of secondary infections leading to pneumonia and acute respiratory distress syndrome (ARDS) preceding the death of the patient.

Indeed, multi-organ failure in 19 patients COVID could be a consequence of comorbidities associated with the patient. Therefore, pre-existing conditions may seem to affect the prognosis of patients whose disease requires immediate attention to accurately detect and evaluate them in the SARS-CoV-2 infected patients.

Here, some of the issues given the findings in relation to the manifestation of the body’s vital organs with potential diagnostic blood factor of SARS-CoV infection-2 will be discussed. It is expected that the review of aid to a more comprehensive understanding of this very complex disease.

Physio-biochemistry, metabolism and excretion of nitrogen ion-regulatory assessment in largemouth bass (Micropterus salmoides) following exposure to high environmental iron

Excess iron is a significant water quality problems in many parts of the world. Therefore, we evaluate the potential toxic effects of waterborne elevated iron in largemouth bass (Micropterus salmoides), sports and cultured fish species is highly appreciated. First, 96 h-LC50 toxicity assay was performed to understand the limits of tolerance of this species to iron; and was determined to be 22.07 mg / L (as Fe 3+).

After that, to get a better insight on fish survival during long-term exposure to high environmental iron (HEI) (5.52 mg / L, 25% of the specified 96-h LC50 value), a suite of physio-biochemistry , nitrogen metabolism and ion-regulatory compensatory responses examined 7, 14, 21 and 28 days.

The results showed that the oxygen consumption decreased significantly at 21 and 28 days of exposure to HEI. Ammonia excretion rate (Jamm) significantly inhibited from day 14 and remained suppressed until the final exposure period. The concentration of Rh glycoproteins Rhcg2 transcripts decreased; efflux decreases the possibility of ammonia from the gills. This change is also reflected in a parallel rise in plasma ammonia levels.

Under exposure to HEI, ion-balance negatively affected, manifested by a decrease in plasma [Na +] and the parallel inhibition of the activity of Na + / K + -ATPase branchial. increased muscle water content in the HEI-exposed fish, suggesting a compromise Osmo-regulation.

Insights into lysosomes PI (3,5) P 2 Homeostasis of-biochemistry Structural Analysis of Complex Lipid Kinase PIKfyve

The phosphoinositide PI (3,5) P2, produced exclusively by PIKfyve lipid kinase complex, is the key to the biology of lysosomes. Here, we explore how to PI (3,5) P2 levels in the cell set. We found PIKfyve complex consists of five copies of the protein scaffold Vac14 and one copy of each lipid kinase PIKfyve, generating PI (3,5) P2 from Fig4 PI3P and lipid phosphatases, reverse reaction.

Fig4 active as a lipid phosphatase in a ternary complex, whereas in cans complex PIKfyve not access Phosphoinositides membrane-inserted because of steric constraints. We find further that the activity of phosphoinositide directed both PIKfyve and Fig4 governed by directed protein activity within the complex. PIKfyve autophosphorylation represses lipid kinase activity and stimulate Fig4 lipid phosphatase activity.

Furthermore, protein phosphatase Fig4 also act on PIKfyve to stimulate the activity of lipid kinases, explaining why Fig4 active catalyst is required for maximum production of PI (3,5) P2 by PIKfyve in vivo.

Monitoring of biochemical changes that happen to human keratinocytes exposed to solar radiation by Raman spectroscopy

exposure to solar radiation is recognized to be a significant contributor to the development of skin cancer. Monitoring mechanism of simultaneous and consecutive interactions can provide a greater understanding of the process photocarcinogenesis. This work presents the analysis of biochemical and morphological changes occur on keratinocytes immortalized human epithelial cell cultures (HaCaT) exposed to simulated solar radiation (SSR).

Cell viability was monitored with the help of test Alamar Blue (AB), morphological examination carried out by hematoxylin and eosin staining (H & E) and changes in the constituents of biochemical (nucleic acids and proteins) as a result of the insult of radiation shown through a combination of Raman microspectroscopy and multivariate analysis spectral pattern.

The results showed that the SSR spectral induces conformational changes in the structure of DNA as a direct result of radiation, while changes in the protein signatures is largely seen as a response later.

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
DLR-TPH2-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tryptophan Hydroxylase 2 (TPH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
DLR-TPH2-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tryptophan Hydroxylase 2 (TPH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RDR-TPH2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RDR-TPH2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RDR-TPH2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RDR-TPH2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RDR-TPH2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RDR-TPH2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RD-TPH2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RD-TPH2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RD-TPH2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RD-TPH2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RD-TPH2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RD-TPH2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

TPH2 antibody
70R-2005	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal TPH2 antibody raised against the middle region of TPH2

TPH2 antibody
70R-2011	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal TPH2 antibody raised against the N terminal of TPH2

TPH2 Antibody
43424-100ul	SAB	100ul	EUR 252

TPH2 Antibody
1-CSB-PA917997	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:10-1:50

TPH2 Antibody
1-CSB-PA809000LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:5000, IHC:1:20-1:200, IF:1:50-1:200

TPH2 Antibody
DF8732	Affbiotech	200ul	EUR 304
Description: TPH2 Antibody detects endogenous levels of total TPH2.

TPH2 Antibody
1-CSB-PA161937	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

TPH2 Antibody
1-CSB-PA006960	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

TPH2 antibody
70R-34658	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal TPH2 antibody

TPH2 Antibody
ABD8732	Lifescience Market	100 ug	EUR 438

TPH2 antibody (Ser19)
70R-15074	Fitzgerald	100 ul	EUR 392
Description: Rabbit polyclonal TPH2 antibody (Ser19)

TPH2 antibody (Ser19)
70R-34657	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal TPH2 antibody (Ser19)

TPH2 antibody (Ser58)
70R-35594	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal TPH2 antibody (Ser58)

TPH2 Conjugated Antibody
C43424	SAB	100ul	EUR 397

TPH2 (pS19) Antibody
abx333346-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

TPH2 Polyclonal Antibody
ABP53691-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19 Applications tips:
Description: A polyclonal antibody for detection of TPH2 from Human, Mouse, Rat, Monkey. This TPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19

TPH2 Polyclonal Antibody
ABP53691-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19 Applications tips:
Description: A polyclonal antibody for detection of TPH2 from Human, Mouse, Rat, Monkey. This TPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19

TPH2 Polyclonal Antibody
ABP53691-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19 Applications tips:
Description: A polyclonal antibody for detection of TPH2 from Human, Mouse, Rat, Monkey. This TPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19

anti- TPH2 antibody
FNab08885	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:100 Immunogen: tryptophan hydroxylase 2 Uniprot ID: Q8IWU9 Gene ID: 121278 Research Area: Neuroscience, Signal Transduction, Metabolism
Description: Antibody raised against TPH2

TPH2 Polyclonal Antibody
ES4690-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TPH2 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA

TPH2 Polyclonal Antibody
ES4690-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TPH2 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-TPH2 antibody
PAab08885	Lifescience Market	100 ug	EUR 355

Anti-TPH2 antibody
STJ116731	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression.

Anti-TPH2 antibody
STJ29227	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression.

Anti-TPH2 antibody
STJ96076	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to TPH2.

Tph2/ Rat Tph2 ELISA Kit
ELI-07130r	Lifescience Market	96 Tests	EUR 886

TPH2 siRNA
20-abx905746	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TPH2 siRNA
20-abx937835	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TPH2 siRNA
20-abx937836	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TPH2 (Ab-19) Antibody
33305-100ul	SAB	100ul	EUR 252

TPH2 (Ab-19) Antibody
33305-50ul	SAB	50ul	EUR 187

TPH2 (Phospho-Ser19) Antibody
11828-100ul	SAB	100ul	EUR 252

TPH2 (Phospho-Ser19) Antibody
11828-50ul	SAB	50ul	EUR 187

Phospho-TPH2 (Ser19) Antibody
CSB-PA123981-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-TPH2 (Ser19). Recognizes Phospho-TPH2 (Ser19) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-TPH2 (Ser19) Antibody
CSB-PA123981-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-TPH2 (Ser19). Recognizes Phospho-TPH2 (Ser19) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

TPH2 Antibody, HRP conjugated
1-CSB-PA809000LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TPH2 Antibody, FITC conjugated
1-CSB-PA809000LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TPH2 Antibody, Biotin conjugated
1-CSB-PA809000LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TPH2 (Ab-19) Antibody
CSB-PA272667-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TPH2 (Ab-19). Recognizes TPH2 (Ab-19) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TPH2 (Ab-19) Antibody
CSB-PA272667-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TPH2 (Ab-19). Recognizes TPH2 (Ab-19) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Phospho-TPH2 (S19) Antibody
1-CSB-PA006958	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-TPH2 (S19). Recognizes Phospho-TPH2 (S19) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

Anti-Tph2 (mouse) antibody
STJ72618	St John's Laboratory	100 µg	EUR 359

TPH2 Rabbit pAb
A14520-100ul	Abclonal	100 ul	EUR 308

TPH2 Rabbit pAb
A14520-200ul	Abclonal	200 ul	EUR 459

TPH2 Rabbit pAb
A14520-20ul	Abclonal	20 ul	EUR 183

TPH2 Rabbit pAb
A14520-50ul	Abclonal	50 ul	EUR 223

TPH2 Blocking Peptide
33R-4561	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TPH2 antibody, catalog no. 70R-2005

TPH2 Blocking Peptide
33R-7865	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TPH2 antibody, catalog no. 70R-2011

TPH2 Blocking Peptide
DF8732-BP	Affbiotech	1mg	EUR 195

TPH2 cloning plasmid
CSB-CL809000HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1491 Sequence: ATGCAGCCAGCAATGATGATGTTTTCCAGTAAATACTGGGCACGGAGAGGGTTTTCCCTGGATTCAGCAGTGCCCGAAGAGCATCAGCTACTTGGCAGCTCAACAGCTTCGACATTCCTGAAGCTAAATAAACCTAACTCTGGCAAAAATGACGACAAAGGCAACAAGGGAAGCA Show more
Description: A cloning plasmid for the TPH2 gene.

TPH2 Rabbit pAb
A7147-100ul	Abclonal	100 ul	EUR 308

TPH2 Rabbit pAb
A7147-200ul	Abclonal	200 ul	EUR 459

TPH2 Rabbit pAb
A7147-20ul	Abclonal	20 ul	EUR 183

TPH2 Rabbit pAb
A7147-50ul	Abclonal	50 ul	EUR 223

Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx005394	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx178740	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx178741	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx178742	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx213944	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx213686	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx129888	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody
abx145380-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx174958	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx174959	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx013001	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx034260	Abbexa	EUR 342.00 EUR 523.00	100 ul 400 ul
Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody
abx034260-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody
abx238885-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

TPH2 (Ab-19) Conjugated Antibody
C33305	SAB	100ul	EUR 397

Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx329873	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody
abx331689-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody
abx430991-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Tryptophan Hydroxylase 2 (Tph2) Antibody
abx431655-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody
abx431656-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx302298	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TPH2 (phospho Ser19) Polyclonal Antibody
ABP53690-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human TPH2 around the phosphorylation site of S19 Applications tips:
Description: A polyclonal antibody for detection of TPH2 phospho Ser19) from Human, Mouse, Rat. This TPH2 phospho Ser19) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the phosphorylation site of S19

TPH2 (phospho Ser19) Polyclonal Antibody
ABP53690-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human TPH2 around the phosphorylation site of S19 Applications tips:
Description: A polyclonal antibody for detection of TPH2 phospho Ser19) from Human, Mouse, Rat. This TPH2 phospho Ser19) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the phosphorylation site of S19

TPH2 (phospho Ser19) Polyclonal Antibody
ABP53690-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human TPH2 around the phosphorylation site of S19 Applications tips:
Description: A polyclonal antibody for detection of TPH2 phospho Ser19) from Human, Mouse, Rat. This TPH2 phospho Ser19) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the phosphorylation site of S19

TPH2 (phospho Ser19) Polyclonal Antibody
ES4689-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TPH2 (phospho Ser19) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TPH2 (phospho Ser19) Polyclonal Antibody
ES4689-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TPH2 (phospho Ser19) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-Phospho-TPH2 (S19) antibody
STJ90661	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Phospho-TPH2 (S19).

Anti-TPH2 (aa16-29) antibody
STJ72617	St John's Laboratory	100 µg	EUR 359

TPH2 (Phospho-Ser19) Polyclonal Conjugated Antibody
C11828	SAB	100ul	EUR 397

Tryptophan Hydroxylase 2 (TPH2) Antibody (HRP)
20-abx316362	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody (FITC)
20-abx316363	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody (Biotin)
20-abx316364	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Tryptophan hydroxylase 2 / TPH2 antibody
STJ70833	St John's Laboratory	100 µg	EUR 359

Human TPH2 ELISA Kit
ELA-E2229h	Lifescience Market	96 Tests	EUR 824

TPH2 ELISA KIT|Human
EF006246	Lifescience Market	96 Tests	EUR 689

Rat TPH2 shRNA Plasmid
20-abx989991	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TPH2 shRNA Plasmid
20-abx964667	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TPH2 shRNA Plasmid
20-abx980994	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TPH2 Recombinant Protein (Rat)
RP234368	ABM	100 ug	Ask for price

TPH2 Recombinant Protein (Human)
RP044410	ABM	100 ug	Ask for price

TPH2 Recombinant Protein (Mouse)
RP180680	ABM	100 ug	Ask for price

Polyclonal TPH2 (aa16-29) Antibody (N-Term)
APR13778G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TPH2 (aa16-29) (N-Term). This antibody is tested and proven to work in the following applications:

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse)
4-PAG343Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPH2 (Met1~Ser138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2)

Tph2 ORF Vector (Rat) (pORF)
ORF078124	ABM	1.0 ug DNA	EUR 506

TPH2 ORF Vector (Human) (pORF)
ORF014804	ABM	1.0 ug DNA	EUR 354

Tph2 ORF Vector (Mouse) (pORF)
ORF060228	ABM	1.0 ug DNA	EUR 506

Recombinant Tryptophan Hydroxylase 2 (TPH2)
4-RPG343Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8CGV2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 45.6kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Tryptophan Hydroxylase 2 expressed in: E.coli

pECMV-Tph2-m-FLAG Plasmid
PVT14992	Lifescience Market	2 ug	EUR 325

TPH2 ELISA Kit (Rat) (OKAN06305)
OKAN06305	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: isoform of tryptophan hydroxylase; may play a role in seratonin biosynthesis [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.56 ng/mL

TPH2 ELISA Kit (Rat) (OKCD02943)
OKCD02943	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.56 ng/mL

TPH2 ELISA Kit (Mouse) (OKCD02950)
OKCD02950	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

TPH2 ELISA Kit (Rat) (OKCA02258)
OKCA02258	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL

TPH2 ELISA Kit (Human) (OKCD08919)
OKCD08919	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Tryptophan hydroxylase (TPH; EC 1.14.16.4) is the rate-limiting enzyme in the synthesis of serotonin (5-hydroxytryptamine, or 5HT). 5HT is causally involved in numerous central nervous activities, and it has several functions in peripheral tissues, including the maintenance of vascular tone and gut motility.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.119ng/mL

Tryptophan Hydroxylase 2 Phospho-Ser19 (TPH2 pS19) Antibody
20-abx012729	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Polyclonal Tryptophan hydroxylase 2 / TPH2 Antibody (internal region)
APR13831G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Tryptophan hydroxylase 2 / TPH2 (internal region). This antibody is tested and proven to work in the following applications:

Tryptophan Hydroxylase 2 Phospho-Ser19 (TPH2 pS19) Antibody
20-abx327772	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), APC
4-PAG343Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPH2 (Met1~Ser138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with APC.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), Biotinylated
4-PAG343Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPH2 (Met1~Ser138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with Biotin.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), Cy3
4-PAG343Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPH2 (Met1~Ser138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with Cy3.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), FITC
4-PAG343Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPH2 (Met1~Ser138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with FITC.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), HRP
4-PAG343Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPH2 (Met1~Ser138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with HRP.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), PE
4-PAG343Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPH2 (Met1~Ser138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with PE.

Mouse Tryptophan Hydroxylase 2 (TPH2) Protein
20-abx168392	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

TPH2 Colorimetric Cell-Based ELISA Kit
EKC1573	BosterBio	100ul	EUR 572

Human Tryptophan Hydroxylase 2 (TPH2) Protein
20-abx655364	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat Tryptophan Hydroxylase 2 (TPH2) Protein
20-abx655365	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
abx595600-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Human Tryptophan 5-hydroxylase 2 (TPH2)
1-CSB-CF809000HU	Cusabio	EUR 965.00 EUR 665.00 EUR 715.00	1MG 200ug 500ug
MW: 60.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tryptophan 5-hydroxylase 2(TPH2) expressed in in vitro E.coli expression system

Tph2 sgRNA CRISPR Lentivector set (Rat)
K7297901	ABM	3 x 1.0 ug	EUR 339

TPH2 sgRNA CRISPR Lentivector set (Human)
K2428101	ABM	3 x 1.0 ug	EUR 339

Tph2 sgRNA CRISPR Lentivector set (Mouse)
K4118401	ABM	3 x 1.0 ug	EUR 339

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG343Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPH2 (Met1~Ser138) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with APC-Cy7.

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
20-abx156179	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
20-abx154794	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
20-abx153361	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tryptophan Hydroxylase 2 (TPH2) CLIA Kit
20-abx495166	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Tryptophan Hydroxylase 2 (TPH2) CLIA Kit
20-abx495167	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Tryptophan Hydroxylase 2 (TPH2) CLIA Kit
20-abx495168	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Tph2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7297902	ABM	1.0 ug DNA	EUR 154

Tph2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7297903	ABM	1.0 ug DNA	EUR 154

Tph2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7297904	ABM	1.0 ug DNA	EUR 154

TPH2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2428102	ABM	1.0 ug DNA	EUR 154

TPH2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2428103	ABM	1.0 ug DNA	EUR 154

TPH2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2428104	ABM	1.0 ug DNA	EUR 154

Tph2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4118402	ABM	1.0 ug DNA	EUR 154

Tph2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4118403	ABM	1.0 ug DNA	EUR 154

Tph2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4118404	ABM	1.0 ug DNA	EUR 154

TPH2 Protein Vector (Rat) (pPB-C-His)
PV312494	ABM	500 ng	EUR 603

TPH2 Protein Vector (Rat) (pPB-N-His)
PV312495	ABM	500 ng	EUR 603

TPH2 Protein Vector (Rat) (pPM-C-HA)
PV312496	ABM	500 ng	EUR 603

TPH2 Protein Vector (Rat) (pPM-C-His)
PV312497	ABM	500 ng	EUR 603

TPH2 Protein Vector (Human) (pPB-C-His)
PV059213	ABM	500 ng	EUR 481

TPH2 Protein Vector (Human) (pPB-N-His)
PV059214	ABM	500 ng	EUR 481

TPH2 Protein Vector (Human) (pPM-C-HA)
PV059215	ABM	500 ng	EUR 481

TPH2 Protein Vector (Human) (pPM-C-His)
PV059216	ABM	500 ng	EUR 481

TPH2 Protein Vector (Mouse) (pPB-C-His)
PV240910	ABM	500 ng	EUR 603

TPH2 Protein Vector (Mouse) (pPB-N-His)
PV240911	ABM	500 ng	EUR 603

TPH2 Protein Vector (Mouse) (pPM-C-HA)
PV240912	ABM	500 ng	EUR 603

TPH2 Protein Vector (Mouse) (pPM-C-His)
PV240913	ABM	500 ng	EUR 603

Human Tryptophan Hydroxylase 2(TPH2)ELISA Kit
QY-E01699	Qayee Biotechnology	96T	EUR 361

Rat Tryptophan Hydroxylase 2(TPH2)ELISA kit
QY-E10113	Qayee Biotechnology	96T	EUR 361

Rat Tryptophan Hydroxylase 2 ELISA Kit (TPH2)
RK03999	Abclonal	96 Tests	EUR 521

Mouse Tryptophan Hydroxylase 2(TPH2)ELISA kit
QY-E21534	Qayee Biotechnology	96T	EUR 361

Tph2 3'UTR Luciferase Stable Cell Line
TU120985	ABM	1.0 ml	Ask for price

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
SEG343Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tryptophan Hydroxylase 2 (TPH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tryptophan Hydroxylase 2 (TPH2) in serum, plasma, tissue homogenates and other biological fluids.

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
SEG343Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tryptophan Hydroxylase 2 (TPH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tryptophan Hydroxylase 2 (TPH2) in serum, plasma, tissue homogenates and other biological fluids.

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
SEG343Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tryptophan Hydroxylase 2 (TPH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tryptophan Hydroxylase 2 (TPH2) in serum, plasma, tissue homogenates and other biological fluids.

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
SEG343Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tryptophan Hydroxylase 2 (TPH2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tryptophan Hydroxylase 2 (TPH2) in serum, plasma, tissue homogenates and other biological fluids.