Effect of flaxseed oil on biochemical parameters, hormonal indexes and stereological changes in ovariectomized rats

Is the ovariectomized rat preclinical model widely used to study the menopause and its complications. In this study, the therapeutic effects of flaxseed oil in ovariectomized adult rats were investigated. Our results suggest that biochemical parameters including levels of calcium, estrogen and progesterone increased 8 weeks after ovariectomy in rats. Also, the amount of alkaline phosphatase decreased significantly after 8 weeks compared to the OVX rats.

Healing potential of flaxseed oil is proven by restoring the affected tissues and prevent the unpleasant symptoms of the mice were ovariectomized. The biological effects of flaxseed oil may be due to the high amount of fatty acids, phytoestrogens, and various antioxidants. The results showed that flaxseed oil can mimic the action of estrogen and may be a potential treatment for hormone replacement therapy (HRT).

biochemical parameters and pathogenesis of SARS-CoV-2 infection in the vital organs: COVID-19 outbreak in Iran

With the emergence of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) outbreaks, humans would witness the first huge threat in the new millennium. Unexpectedly, the coronavirus disease in 2019 (COVID-19) spread the world leads to the death toll continues to rise. vital organs SARS-CoV-2 perturbs infection makes the body function patients of all ages are susceptible to this disease.

However, individuals develop critical illness with poor outcomes are mostly elderly people and people who have comorbid conditions that constitute the majority of COVID 19 fatalities. The COVID 19th most complications involving the respiratory system, kidneys and cardiovascular, and in severe cases of secondary infections leading to pneumonia and acute respiratory distress syndrome (ARDS) preceding the death of the patient.

Indeed, multi-organ failure in 19 patients COVID could be a consequence of comorbidities associated with the patient. Therefore, pre-existing conditions may seem to affect the prognosis of patients whose disease requires immediate attention to accurately detect and evaluate them in the SARS-CoV-2 infected patients.

Here, some of the issues given the findings in relation to the manifestation of the body’s vital organs with potential diagnostic blood factor of SARS-CoV infection-2 will be discussed. It is expected that the review of aid to a more comprehensive understanding of this very complex disease.

Physio-biochemistry, metabolism and excretion of nitrogen ion-regulatory assessment in largemouth bass (Micropterus salmoides) following exposure to high environmental iron

Excess iron is a significant water quality problems in many parts of the world. Therefore, we evaluate the potential toxic effects of waterborne elevated iron in largemouth bass (Micropterus salmoides), sports and cultured fish species is highly appreciated. First, 96 h-LC50 toxicity assay was performed to understand the limits of tolerance of this species to iron; and was determined to be 22.07 mg / L (as Fe 3+).

After that, to get a better insight on fish survival during long-term exposure to high environmental iron (HEI) (5.52 mg / L, 25% of the specified 96-h LC50 value), a suite of physio-biochemistry , nitrogen metabolism and ion-regulatory compensatory responses examined 7, 14, 21 and 28 days.

The results showed that the oxygen consumption decreased significantly at 21 and 28 days of exposure to HEI. Ammonia excretion rate (Jamm) significantly inhibited from day 14 and remained suppressed until the final exposure period. The concentration of Rh glycoproteins Rhcg2 transcripts decreased; efflux decreases the possibility of ammonia from the gills. This change is also reflected in a parallel rise in plasma ammonia levels.

Under exposure to HEI, ion-balance negatively affected, manifested by a decrease in plasma [Na +] and the parallel inhibition of the activity of Na + / K + -ATPase branchial. increased muscle water content in the HEI-exposed fish, suggesting a compromise Osmo-regulation.

Insights into lysosomes PI (3,5) P 2 Homeostasis of-biochemistry Structural Analysis of Complex Lipid Kinase PIKfyve

The phosphoinositide PI (3,5) P2, produced exclusively by PIKfyve lipid kinase complex, is the key to the biology of lysosomes. Here, we explore how to PI (3,5) P2 levels in the cell set. We found PIKfyve complex consists of five copies of the protein scaffold Vac14 and one copy of each lipid kinase PIKfyve, generating PI (3,5) P2 from Fig4 PI3P and lipid phosphatases, reverse reaction.

Fig4 active as a lipid phosphatase in a ternary complex, whereas in cans complex PIKfyve not access Phosphoinositides membrane-inserted because of steric constraints. We find further that the activity of phosphoinositide directed both PIKfyve and Fig4 governed by directed protein activity within the complex. PIKfyve autophosphorylation represses lipid kinase activity and stimulate Fig4 lipid phosphatase activity.

Furthermore, protein phosphatase Fig4 also act on PIKfyve to stimulate the activity of lipid kinases, explaining why Fig4 active catalyst is required for maximum production of PI (3,5) P2 by PIKfyve in vivo.

Monitoring of biochemical changes that happen to human keratinocytes exposed to solar radiation by Raman spectroscopy

exposure to solar radiation is recognized to be a significant contributor to the development of skin cancer. Monitoring mechanism of simultaneous and consecutive interactions can provide a greater understanding of the process photocarcinogenesis. This work presents the analysis of biochemical and morphological changes occur on keratinocytes immortalized human epithelial cell cultures (HaCaT) exposed to simulated solar radiation (SSR).

Cell viability was monitored with the help of test Alamar Blue (AB), morphological examination carried out by hematoxylin and eosin staining (H & E) and changes in the constituents of biochemical (nucleic acids and proteins) as a result of the insult of radiation shown through a combination of Raman microspectroscopy and multivariate analysis spectral pattern.

The results showed that the SSR spectral induces conformational changes in the structure of DNA as a direct result of radiation, while changes in the protein signatures is largely seen as a response later.

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DLR-TPH2-Ra-48T 48T
EUR 549
  • Should the Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tryptophan Hydroxylase 2 (TPH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

DLR-TPH2-Ra-96T 96T
EUR 718
  • Should the Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tryptophan Hydroxylase 2 (TPH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RDR-TPH2-Hu-48Tests 48 Tests
EUR 544

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RDR-TPH2-Hu-96Tests 96 Tests
EUR 756

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RDR-TPH2-Mu-48Tests 48 Tests
EUR 557

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RDR-TPH2-Mu-96Tests 96 Tests
EUR 774

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RDR-TPH2-Ra-48Tests 48 Tests
EUR 583

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RDR-TPH2-Ra-96Tests 96 Tests
EUR 811

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RD-TPH2-Hu-48Tests 48 Tests
EUR 521

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RD-TPH2-Hu-96Tests 96 Tests
EUR 723

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RD-TPH2-Mu-48Tests 48 Tests
EUR 533

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RD-TPH2-Mu-96Tests 96 Tests
EUR 740

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RD-TPH2-Ra-48Tests 48 Tests
EUR 557

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

RD-TPH2-Ra-96Tests 96 Tests
EUR 775

TPH2 antibody

70R-2005 50 ug
EUR 467
Description: Rabbit polyclonal TPH2 antibody raised against the middle region of TPH2

TPH2 antibody

70R-2011 50 ug
EUR 467
Description: Rabbit polyclonal TPH2 antibody raised against the N terminal of TPH2

TPH2 Antibody

43424-100ul 100ul
EUR 252

TPH2 Antibody

1-CSB-PA917997
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:10-1:50

TPH2 Antibody

1-CSB-PA809000LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:5000, IHC:1:20-1:200, IF:1:50-1:200

TPH2 Antibody

DF8732 200ul
EUR 304
Description: TPH2 Antibody detects endogenous levels of total TPH2.

TPH2 Antibody

1-CSB-PA161937
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

TPH2 Antibody

1-CSB-PA006960
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

TPH2 antibody

70R-34658 100 ug
EUR 327
Description: Purified Rabbit polyclonal TPH2 antibody

TPH2 Antibody

ABD8732 100 ug
EUR 438

TPH2 antibody (Ser19)

70R-15074 100 ul
EUR 392
Description: Rabbit polyclonal TPH2 antibody (Ser19)

TPH2 antibody (Ser19)

70R-34657 100 ug
EUR 327
Description: Purified Rabbit polyclonal TPH2 antibody (Ser19)

TPH2 antibody (Ser58)

70R-35594 100 ug
EUR 327
Description: Rabbit polyclonal TPH2 antibody (Ser58)

TPH2 Conjugated Antibody

C43424 100ul
EUR 397

TPH2 (pS19) Antibody

abx333346-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

TPH2 Polyclonal Antibody

ABP53691-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 from Human, Mouse, Rat, Monkey. This TPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19

TPH2 Polyclonal Antibody

ABP53691-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 from Human, Mouse, Rat, Monkey. This TPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19

TPH2 Polyclonal Antibody

ABP53691-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 from Human, Mouse, Rat, Monkey. This TPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19

anti- TPH2 antibody

FNab08885 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: tryptophan hydroxylase 2
  • Uniprot ID: Q8IWU9
  • Gene ID: 121278
  • Research Area: Neuroscience, Signal Transduction, Metabolism
Description: Antibody raised against TPH2

TPH2 Polyclonal Antibody

ES4690-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TPH2 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA

TPH2 Polyclonal Antibody

ES4690-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TPH2 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-TPH2 antibody

PAab08885 100 ug
EUR 355

Anti-TPH2 antibody

STJ116731 100 µl
EUR 277
Description: This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression.

Anti-TPH2 antibody

STJ29227 100 µl
EUR 277
Description: This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression.

Anti-TPH2 antibody

STJ96076 200 µl
EUR 197
Description: Rabbit polyclonal to TPH2.

Tph2/ Rat Tph2 ELISA Kit

ELI-07130r 96 Tests
EUR 886

TPH2 siRNA

20-abx905746
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPH2 siRNA

20-abx937835
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPH2 siRNA

20-abx937836
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPH2 (Ab-19) Antibody

33305-100ul 100ul
EUR 252

TPH2 (Ab-19) Antibody

33305-50ul 50ul
EUR 187

TPH2 (Phospho-Ser19) Antibody

11828-100ul 100ul
EUR 252

TPH2 (Phospho-Ser19) Antibody

11828-50ul 50ul
EUR 187

Phospho-TPH2 (Ser19) Antibody

CSB-PA123981-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-TPH2 (Ser19). Recognizes Phospho-TPH2 (Ser19) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-TPH2 (Ser19) Antibody

CSB-PA123981-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-TPH2 (Ser19). Recognizes Phospho-TPH2 (Ser19) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

TPH2 Antibody, HRP conjugated

1-CSB-PA809000LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TPH2 Antibody, FITC conjugated

1-CSB-PA809000LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TPH2 Antibody, Biotin conjugated

1-CSB-PA809000LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TPH2 (Ab-19) Antibody

CSB-PA272667-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TPH2 (Ab-19). Recognizes TPH2 (Ab-19) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TPH2 (Ab-19) Antibody

CSB-PA272667-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TPH2 (Ab-19). Recognizes TPH2 (Ab-19) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Phospho-TPH2 (S19) Antibody

1-CSB-PA006958
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-TPH2 (S19). Recognizes Phospho-TPH2 (S19) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

Anti-Tph2 (mouse) antibody

STJ72618 100 µg
EUR 359

TPH2 Rabbit pAb

A14520-100ul 100 ul
EUR 308

TPH2 Rabbit pAb

A14520-200ul 200 ul
EUR 459

TPH2 Rabbit pAb

A14520-20ul 20 ul
EUR 183

TPH2 Rabbit pAb

A14520-50ul 50 ul
EUR 223

TPH2 Blocking Peptide

33R-4561 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TPH2 antibody, catalog no. 70R-2005

TPH2 Blocking Peptide

33R-7865 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TPH2 antibody, catalog no. 70R-2011

TPH2 Blocking Peptide

DF8732-BP 1mg
EUR 195

TPH2 cloning plasmid

CSB-CL809000HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1491
  • Sequence: ATGCAGCCAGCAATGATGATGTTTTCCAGTAAATACTGGGCACGGAGAGGGTTTTCCCTGGATTCAGCAGTGCCCGAAGAGCATCAGCTACTTGGCAGCTCAACAGCTTCGACATTCCTGAAGCTAAATAAACCTAACTCTGGCAAAAATGACGACAAAGGCAACAAGGGAAGCA
  • Show more
Description: A cloning plasmid for the TPH2 gene.

TPH2 Rabbit pAb

A7147-100ul 100 ul
EUR 308

TPH2 Rabbit pAb

A7147-200ul 200 ul
EUR 459

TPH2 Rabbit pAb

A7147-20ul 20 ul
EUR 183

TPH2 Rabbit pAb

A7147-50ul 50 ul
EUR 223

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx005394
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx178740
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx178741
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx178742
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx213944
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx213686
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx129888
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

abx145380-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx174958
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx174959
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx013001
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx034260
  • EUR 342.00
  • EUR 523.00
  • 100 ul
  • 400 ul
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

abx034260-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

abx238885-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

TPH2 (Ab-19) Conjugated Antibody

C33305 100ul
EUR 397

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx329873
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

abx331689-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

abx430991-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Tryptophan Hydroxylase 2 (Tph2) Antibody

abx431655-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

abx431656-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody

20-abx302298
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TPH2 (phospho Ser19) Polyclonal Antibody

ABP53690-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human TPH2 around the phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 phospho Ser19) from Human, Mouse, Rat. This TPH2 phospho Ser19) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the phosphorylation site of S19

TPH2 (phospho Ser19) Polyclonal Antibody

ABP53690-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human TPH2 around the phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 phospho Ser19) from Human, Mouse, Rat. This TPH2 phospho Ser19) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the phosphorylation site of S19

TPH2 (phospho Ser19) Polyclonal Antibody

ABP53690-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human TPH2 around the phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 phospho Ser19) from Human, Mouse, Rat. This TPH2 phospho Ser19) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the phosphorylation site of S19

TPH2 (phospho Ser19) Polyclonal Antibody

ES4689-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TPH2 (phospho Ser19) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TPH2 (phospho Ser19) Polyclonal Antibody

ES4689-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TPH2 (phospho Ser19) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-Phospho-TPH2 (S19) antibody

STJ90661 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-TPH2 (S19).

Anti-TPH2 (aa16-29) antibody

STJ72617 100 µg
EUR 359

TPH2 (Phospho-Ser19) Polyclonal Conjugated Antibody

C11828 100ul
EUR 397

Tryptophan Hydroxylase 2 (TPH2) Antibody (HRP)

20-abx316362
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody (FITC)

20-abx316363
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Antibody (Biotin)

20-abx316364
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Tryptophan hydroxylase 2 / TPH2 antibody

STJ70833 100 µg
EUR 359

Human TPH2 ELISA Kit

ELA-E2229h 96 Tests
EUR 824

TPH2 ELISA KIT|Human

EF006246 96 Tests
EUR 689

Rat TPH2 shRNA Plasmid

20-abx989991
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TPH2 shRNA Plasmid

20-abx964667
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TPH2 shRNA Plasmid

20-abx980994
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TPH2 Recombinant Protein (Rat)

RP234368 100 ug Ask for price

TPH2 Recombinant Protein (Human)

RP044410 100 ug Ask for price

TPH2 Recombinant Protein (Mouse)

RP180680 100 ug Ask for price

Polyclonal TPH2 (aa16-29) Antibody (N-Term)

APR13778G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TPH2 (aa16-29) (N-Term). This antibody is tested and proven to work in the following applications:

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse)

4-PAG343Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2)

Tph2 ORF Vector (Rat) (pORF)

ORF078124 1.0 ug DNA
EUR 506

TPH2 ORF Vector (Human) (pORF)

ORF014804 1.0 ug DNA
EUR 354

Tph2 ORF Vector (Mouse) (pORF)

ORF060228 1.0 ug DNA
EUR 506

Recombinant Tryptophan Hydroxylase 2 (TPH2)

4-RPG343Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8CGV2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 45.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Tryptophan Hydroxylase 2 expressed in: E.coli

pECMV-Tph2-m-FLAG Plasmid

PVT14992 2 ug
EUR 325

TPH2 ELISA Kit (Rat) (OKAN06305)

OKAN06305 96 Wells
EUR 792
Description: Description of target: isoform of tryptophan hydroxylase; may play a role in seratonin biosynthesis [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.56 ng/mL

TPH2 ELISA Kit (Rat) (OKCD02943)

OKCD02943 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.56 ng/mL

TPH2 ELISA Kit (Mouse) (OKCD02950)

OKCD02950 96 Wells
EUR 857
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

TPH2 ELISA Kit (Rat) (OKCA02258)

OKCA02258 96 Wells
EUR 833
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL

TPH2 ELISA Kit (Human) (OKCD08919)

OKCD08919 96 Wells
EUR 975
Description: Description of target: Tryptophan hydroxylase (TPH; EC 1.14.16.4) is the rate-limiting enzyme in the synthesis of serotonin (5-hydroxytryptamine, or 5HT). 5HT is causally involved in numerous central nervous activities, and it has several functions in peripheral tissues, including the maintenance of vascular tone and gut motility.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.119ng/mL

Tryptophan Hydroxylase 2 Phospho-Ser19 (TPH2 pS19) Antibody

20-abx012729
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Polyclonal Tryptophan hydroxylase 2 / TPH2 Antibody (internal region)

APR13831G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Tryptophan hydroxylase 2 / TPH2 (internal region). This antibody is tested and proven to work in the following applications:

Tryptophan Hydroxylase 2 Phospho-Ser19 (TPH2 pS19) Antibody

20-abx327772
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), APC

4-PAG343Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with APC.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), Biotinylated

4-PAG343Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with Biotin.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), Cy3

4-PAG343Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with Cy3.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), FITC

4-PAG343Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with FITC.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), HRP

4-PAG343Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with HRP.

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), PE

4-PAG343Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with PE.

Mouse Tryptophan Hydroxylase 2 (TPH2) Protein

20-abx168392
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TPH2 Colorimetric Cell-Based ELISA Kit

EKC1573 100ul
EUR 572

Human Tryptophan Hydroxylase 2 (TPH2) Protein

20-abx655364
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Tryptophan Hydroxylase 2 (TPH2) Protein

20-abx655365
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

abx595600-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human Tryptophan 5-hydroxylase 2 (TPH2)

1-CSB-CF809000HU
  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 60.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tryptophan 5-hydroxylase 2(TPH2) expressed in in vitro E.coli expression system

Tph2 sgRNA CRISPR Lentivector set (Rat)

K7297901 3 x 1.0 ug
EUR 339

TPH2 sgRNA CRISPR Lentivector set (Human)

K2428101 3 x 1.0 ug
EUR 339

Tph2 sgRNA CRISPR Lentivector set (Mouse)

K4118401 3 x 1.0 ug
EUR 339

Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), APC-Cy7

4-PAG343Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with APC-Cy7.

Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

20-abx156179
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

20-abx154794
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

20-abx153361
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tryptophan Hydroxylase 2 (TPH2) CLIA Kit

20-abx495166
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Tryptophan Hydroxylase 2 (TPH2) CLIA Kit

20-abx495167
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Tryptophan Hydroxylase 2 (TPH2) CLIA Kit

20-abx495168
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Tph2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7297902 1.0 ug DNA
EUR 154

Tph2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7297903 1.0 ug DNA
EUR 154

Tph2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7297904 1.0 ug DNA
EUR 154

TPH2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2428102 1.0 ug DNA
EUR 154

TPH2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2428103 1.0 ug DNA
EUR 154

TPH2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2428104 1.0 ug DNA
EUR 154

Tph2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4118402 1.0 ug DNA
EUR 154

Tph2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4118403 1.0 ug DNA
EUR 154

Tph2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4118404 1.0 ug DNA
EUR 154

TPH2 Protein Vector (Rat) (pPB-C-His)

PV312494 500 ng
EUR 603

TPH2 Protein Vector (Rat) (pPB-N-His)

PV312495 500 ng
EUR 603

TPH2 Protein Vector (Rat) (pPM-C-HA)

PV312496 500 ng
EUR 603

TPH2 Protein Vector (Rat) (pPM-C-His)

PV312497 500 ng
EUR 603

TPH2 Protein Vector (Human) (pPB-C-His)

PV059213 500 ng
EUR 481

TPH2 Protein Vector (Human) (pPB-N-His)

PV059214 500 ng
EUR 481

TPH2 Protein Vector (Human) (pPM-C-HA)

PV059215 500 ng
EUR 481

TPH2 Protein Vector (Human) (pPM-C-His)

PV059216 500 ng
EUR 481

TPH2 Protein Vector (Mouse) (pPB-C-His)

PV240910 500 ng
EUR 603

TPH2 Protein Vector (Mouse) (pPB-N-His)

PV240911 500 ng
EUR 603

TPH2 Protein Vector (Mouse) (pPM-C-HA)

PV240912 500 ng
EUR 603

TPH2 Protein Vector (Mouse) (pPM-C-His)

PV240913 500 ng
EUR 603

Human Tryptophan Hydroxylase 2(TPH2)ELISA Kit

QY-E01699 96T
EUR 361

Rat Tryptophan Hydroxylase 2(TPH2)ELISA kit

QY-E10113 96T
EUR 361

Rat Tryptophan Hydroxylase 2 ELISA Kit (TPH2)

RK03999 96 Tests
EUR 521

Mouse Tryptophan Hydroxylase 2(TPH2)ELISA kit

QY-E21534 96T
EUR 361

Tph2 3'UTR Luciferase Stable Cell Line

TU120985 1.0 ml Ask for price

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

SEG343Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tryptophan Hydroxylase 2 (TPH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tryptophan Hydroxylase 2 (TPH2) in serum, plasma, tissue homogenates and other biological fluids.

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

SEG343Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tryptophan Hydroxylase 2 (TPH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tryptophan Hydroxylase 2 (TPH2) in serum, plasma, tissue homogenates and other biological fluids.

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

SEG343Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tryptophan Hydroxylase 2 (TPH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tryptophan Hydroxylase 2 (TPH2) in serum, plasma, tissue homogenates and other biological fluids.

Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit

SEG343Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tryptophan Hydroxylase 2 (TPH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tryptophan Hydroxylase 2 (TPH2) in serum, plasma, tissue homogenates and other biological fluids.

Leave a Reply

Your email address will not be published. Required fields are marked *