Structural and biochemical insights into the substrate selectivity and catalysis of hexachlorobenzene monooxygenase

Hexachlorobenzene (HCB), as one of the persistent organic pollutants (POPs) and possible human carcinogens, particularly resistant to biodegradation. In this study, HcbA1A3, a different flavin-N5-peroxide using enzymes and the only known naturally aerobic dechlorinase HCB, the biochemical marked.

Its clear preference for HCB in the binding affinity of sets that can only oxidize HcbA1 HCB than less chlorinated benzene as pentachlorobenzene and tetrachlorobenzenes. In addition, the crystal structure and complex HcbA1 with FMN resolved, revealing HcbA1 as new members of the bacterial luciferase-like family. Compared with a close homolog, the substrate binding pocket is much smaller than HcbA1 show limited space requirements for catalysis.

In the midst of an active, Tyr362 and Asp315 necessary in maintaining a normal conformation HcbA1, while Arg311, Arg314, Phe10, Val59 and Met12 is important for substrate affinity. They should have a place in the productive orientation HCB through multiple interactions. His17, with close contact with the oxidation locations HCB, possibly targeting the improvement of chlorine atoms and stabilizing the reaction intermediates.

Enzymatic characteristics and crystal structures reported here provide new insights into the substrate specificity and catalytic mechanism HcbA1, which opens the way for rational engineering and applications in bioremediation of polluted HCB environments.IMPORTANCE As an endocrine disruptor and possible carcinogen to humans, hexachlorobenzene (HCB) is resistant to biodegradation, largely due to difficulties in dechlorination.

Lack of knowledge to dechlorinases HCB limit their application in bioremediation. More recently, a HcbA1A3 monooxygenases reported HCB, which is the only known naturally aerobic HCB dechlorinase so far. Here we report the biochemical and structural characterization, which provides new insight into the substrate selectivity and catalytic mechanism. The study also improve our understanding of dechlorinases HCB and flavin-N5-peroxide using enzymes.

Ensuring the biochemical function of pectin methylesterase important in microbial gut Bacteroides thetaiotaomicron

Pectin is a major food source of nutrients for the human intestinal microbiota (HGM). Bacteroides thetaiotaomicron protruding gut microbes was recently shown to encode a founding member of (BT1017) of a new family of pectin methylesterases (PMEs) important for the metabolism of pectin complex rhamnogalacturonan-II (RG-II).

However, the biochemical and structural knowledge of this family less. Here, we show that the BT1017 is very important for the metabolism of a ΔBT1017oligoB oligosaccharides derived RG-II produced by BT1017 deletion mutant (ΔBT1017) during growth on carbohydrate extract of apple juice.

ΔBT1017oligoB structural analysis using a combination of enzymatic, mass spectrometry and nuclear magnetic resonance approach to reveal that it was a lady-oligosaccharides bi-methylated GlcA-β1,4- (2-O-Me-Xyl-α1,3) -Fuc- α1,4- (gALA-β1,3) -Rha-α1,3-Fire-β1,2- (Araf-α1,3) – (gala-α1,4) -GalA component containing RG-II backbones and side chains. We show that the catalytic module BT1017 adopt an alpha / beta (α / β) hydrolase fold, which consists of 10 twisted β-sheet strand middle sandwiched by multiple α-helices. It is a new fold for PMEs, which is dominated by left-handed β-helix proteins.

Bioinformatics analysis revealed that the family is dominated by a sequence of genera protruding from HGM, including Bacteroides and Prevotella Our results not only highlight the important role played by this family of enzymes in the metabolism of pectin but give new insights into the molecular basis of adaptation B. thetaiotaomicron to gut human.

Cellular and biochemical mechanisms of meroterpenoid Oncocalyxone antileukemic A

Oncocalyxone A, 1,4-benzokuinon derived from Cordia oncocalyx, showed anti-inflammatory, antimicrobial and anti-diabetic. The purpose of this study was to (1) examine the cytotoxic action oncocalyxone A on normal and tumor cell lines of human and (2) determine the mechanistic action effects on leukemia cells using the technique of the underlying cellular and molecular.

Antiproliferative studies on cancer cell lines, cells of peripheral blood mononuclear cells, and human erythrocytes done using colorimetric tests. To understand cytotoxicity, an assessment carried out by the HL-60 leukemia cells (8, 16.5, or 33 M) after 24 h incubation by using light and fluorescence microscopy, trypan blue, cytometry, Comet assay, western blot caspases and poly-ADP- flow ribose polymerase (PARP), and the effect on topoisomerase I and II. A Oncocalyxone exhibited cytotoxic action in HL-60 cells and dividing leukocytes, but minimal hemolytic action on erythrocytes.

The mechanistic investigation showed a decrease in cell viability, loss of membrane integrity, cells shrink, chromatin condensation, blebbings, phosphatidylserine externalization, caspase activation, PARP cleavage, mitochondrial depolarization and DNA damage. Pre-treatment with N-acetylcysteine ​​4 mM significantly reduced DNA damage and prevent the loss of membrane integrity. Oncocalyxone A free radical activity depends shown antileukemic through apoptosis and DNA damage induced in HL-60 cells.

Oncocalyxone A has a chemical structural simplicity allows it to be a cost-effective alternative. These properties justify further improvements to improve the activity and selectivity and pharmaceutical formulation development. Abbreviations Acridine orange, AO; ANOVA, analysis of variance; BSA, bovine serum albumin; IN, Damage Index; DMSO, Dimethylsulfoxide; EC50, the effective concentration of 50%; EDTA, ethylenediamine tetraacetic acid; EB, ethidium bromide; HCT-116, colon carcinoma lines; HL-60, promyelocytic leukemia line; IC50, 50% inhibitory concentration; MTT, 3- (4,5-dimethyl-2-thiazolyl) -2,5-diphenyl-2H-tetrazolium bromide; OVCAR-8 ovarian carcinoma line; NAC, N-acetylcysteine, PBMC, peripheral blood mononuclear cells; PBS, phosphate-buffered saline; PI, propidium iodide; PARP, poly-ADP-ribose polymerase; RPMI-1640 media Roswell Park Memorial Institute; SF-295 glioblastoma line; ROS, reactive oxygen species; 7-AAD, 7-amino-aktinomisin D; H2-DCF-DA, 7′-dichlorodihydrofluorescein diacetate.

Biochemistry and in silico identification of the active site and catalytic mechanisms of circadian HESPERIN deadenylase

24h a molecular clock based on the stability of the transcript rhythmic disclosed. Shortening of the poly (A) tail of the mRNA is often the first step and the rate-limiting determine the life span of mRNA and catalyzed by deadenylases.

Here, we determine the catalytic site Hesperin, a circadian deadenylase recently described in plants, using a modified site-directed mutagenesis protocols and custom vectors, pATHRA. To explore the catalytic efficiency of AtHESPERIN we examined the effect of AMP and neomycin, and used molecular modeling simulations to propose a catalytic mechanism.

Collectively, biochemistry and classify AtHESPERIN silico results in EEP deadenylase superfamily and contribute to the understanding of the complex mechanisms of circadian mRNA turnover.

 

 

Rat Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit
DLR-ALOX5-Ra-48T	DL Develop	48T	EUR 528
Should the Rat Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Arachidonate-5-Lipoxygenase (ALOX5) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit
DLR-ALOX5-Ra-96T	DL Develop	96T	EUR 690
Should the Rat Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Arachidonate-5-Lipoxygenase (ALOX5) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit
RD-ALOX5-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit
RD-ALOX5-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit
RD-ALOX5-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit
RD-ALOX5-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit
RD-ALOX5-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit
RD-ALOX5-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Human Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit
RDR-ALOX5-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit
RDR-ALOX5-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Mouse Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit
RDR-ALOX5-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534

Mouse Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit
RDR-ALOX5-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742

Rat Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit
RDR-ALOX5-Ra-48Tests	Reddot Biotech	48 Tests	EUR 558

Rat Arachidonate-5-Lipoxygenase (ALOX5) ELISA Kit
RDR-ALOX5-Ra-96Tests	Reddot Biotech	96 Tests	EUR 776

ALOX5 antibody
70R-33363	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ALOX5 antibody

ALOX5 Antibody
ABD6881	Lifescience Market	100 ug	EUR 438

ALOX5 Antibody
35564-100ul	SAB	100ul	EUR 252

ALOX5 antibody
38389-100ul	SAB	100ul	EUR 252

ALOX5 antibody
70R-14181	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal ALOX5 antibody

ALOX5 antibody
70R-15688	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ALOX5 antibody

ALOX5 Antibody
DF6881	Affbiotech	200ul	EUR 304
Description: ALOX5 Antibody detects endogenous levels of total ALOX5.

ALOX5 Antibody
1-CSB-PA001624GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Protein A Purified
Description: A polyclonal antibody against ALOX5. Recognizes ALOX5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF

ALOX5 Antibody
1-CSB-PA001624LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALOX5. Recognizes ALOX5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ALOX5 Antibody
1-CSB-PA008474	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ALOX5. Recognizes ALOX5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

ALOX5 Antibody
1-CSB-PA787659	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ALOX5. Recognizes ALOX5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:500-1:2000, IHC:1:25-1:100

ALOX5 Antibody
1-CSB-PA043268	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ALOX5. Recognizes ALOX5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:500-1:5000, IHC:1:50-1:150

ALOX5 Conjugated Antibody
C35564	SAB	100ul	EUR 397

ALOX5 (pS271) Antibody
20-abx123322	Abbexa	EUR 495.00 EUR 704.00 EUR 217.00 EUR 356.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

ALOX5 (pS663) Antibody
abx148138-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

ALOX5 (pS523) Antibody
abx012014-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

ALOX5 Polyclonal Antibody
A58062	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

ALOX5 antibody (Ser271)
70R-33362	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ALOX5 antibody (Ser271)

ALOX5 antibody (Ser523)
70R-34631	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal ALOX5 antibody (Ser523)

Anti-ALOX5 Antibody
A1747-100	Biovision		EUR 479

ALOX5 antibody (Ser523)
70R-14936	Fitzgerald	100 ul	EUR 392
Description: Rabbit polyclonal ALOX5 antibody (Ser523)

Anti-ALOX5 antibody
STJ22592	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the lipoxygenase gene family and plays a dual role in the synthesis of leukotrienes from arachidonic acid. The encoded protein, which is expressed specifically in bone marrow-derived cells, catalyzes the conversion of arachidonic acid to 5(S)-hydroperoxy-6-trans-8,11,14-cis-eicosatetraenoic acid, and further to the allylic epoxide 5(S)-trans-7,9-trans-11,14-cis-eicosatetrenoic acid (leukotriene A4). Leukotrienes are important mediators of a number of inflammatory and allergic conditions. Mutations in the promoter region of this gene lead to a diminished response to antileukotriene drugs used in the treatment of asthma and may also be associated with atherosclerosis and several cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Alox5/ Rat Alox5 ELISA Kit
ELI-04466r	Lifescience Market	96 Tests	EUR 886

ALOX5 siRNA
20-abx900294	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ALOX5 siRNA
20-abx907323	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ALOX5 siRNA
20-abx907324	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Phospho-ALOX5 (Ser663) Antibody
AF8359	Affbiotech	200ul	EUR 376
Description: ALOX5 (Phospho-Ser663) Antibody detects endogenous levels of ALOX5 only when phosphorylated at Ser663.

Phospho-ALOX5(Ser523) Antibody
AF0064	Affbiotech	200ul	EUR 304
Description: Phospho-ALOX5(Ser523) Antibody detects endogenous levels of ALOX5 only when phosphorylated at Sersine 523.

ALOX5 (Phospho- Ser663) Antibody
ABF8359	Lifescience Market	100 ug	EUR 438

Phospho- ALOX5 (Ser523) Antibody
ABF0064	Lifescience Market	100 ug	EUR 438

Phospho-ALOX5 (Ser523) Antibody
A1714-100	Biovision		EUR 479

ALOX5 (Phospho-Ser523) Antibody
12128-100ul	SAB	100ul	EUR 252

ALOX5 (Phospho-Ser523) Antibody
12128-50ul	SAB	50ul	EUR 187

ALOX5 (Phospho-Ser663) Antibody
12671-100ul	SAB	100ul	EUR 252

ALOX5 (Phospho-Ser663) Antibody
12671-50ul	SAB	50ul	EUR 187

ALOX5 Antibody, HRP conjugated
1-CSB-PA001624LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALOX5. Recognizes ALOX5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ALOX5 Antibody, FITC conjugated
1-CSB-PA001624LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALOX5. Recognizes ALOX5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ALOX5 Antibody, Biotin conjugated
1-CSB-PA001624LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALOX5. Recognizes ALOX5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-ALOX5 (S523) Antibody
1-CSB-PA008470	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ALOX5 (S523). Recognizes Phospho-ALOX5 (S523) from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

Phospho-ALOX5 (S272) Antibody
1-CSB-PA008472	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ALOX5 (S272). Recognizes Phospho-ALOX5 (S272) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-ALOX5 (Ser523) Antibody
CSB-PA555261-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-ALOX5 (Ser523). Recognizes Phospho-ALOX5 (Ser523) from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Phospho-ALOX5 (Ser523) Antibody
CSB-PA555261-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-ALOX5 (Ser523). Recognizes Phospho-ALOX5 (Ser523) from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Arachidonate-5-Lipoxygenase (ALOX5) Antibody
20-abx128567	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Arachidonate-5-Lipoxygenase (ALOX5) Antibody
20-abx111039	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Arachidonate 5-Lipoxygenase (ALOX5) Antibody
20-abx001770	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Arachidonate-5-Lipoxygenase (ALOX5) Antibody
20-abx102800	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Arachidonate-5-Lipoxygenase (ALOX5) Antibody
20-abx102801	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Arachidonate-5-Lipoxygenase (ALOX5) Antibody
20-abx102802	Abbexa	EUR 328.00 EUR 815.00 EUR 425.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Arachidonate-5-Lipoxygenase (ALOX5) Antibody
20-abx175461	Abbexa	EUR 1247.00 EUR 592.00	1 mg 200 ug
Please enquire.

Arachidonate-5-Lipoxygenase (ALOX5) Antibody
20-abx328184	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Arachidonate-5-Lipoxygenase (ALOX5) Antibody
20-abx242416	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Arachidonate-5-Lipoxygenase (ALOX5) Antibody
20-abx242434	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Arachidonate 5-Lipoxygenase (ALOX5) Antibody
20-abx301130	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Arachidonate-5-Lipoxygenase (ALOX5) Antibody
20-abx171312	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Arachidonate-5-Lipoxygenase (ALOX5) Antibody
20-abx171313	Abbexa	EUR 871.00 EUR 453.00	1 mg 200 ug
Please enquire.

ALOX5 Polyclonal Antibody, Biotin Conjugated
A58063	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

ALOX5 Polyclonal Antibody, FITC Conjugated
A58064	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

ALOX5 Polyclonal Antibody, HRP Conjugated
A58065	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Anti-5 Lipoxygenase/ALOX5 Antibody
PA1644	BosterBio	100ug/vial	EUR 334

Anti-5 Lipoxygenase/ALOX5 Antibody
RP1031	BosterBio	100ug/vial	EUR 334

Anti-Phospho-ALOX5-(S271) antibody
STJ29339	St John's Laboratory	100 µl	EUR 393
Description: This gene encodes a member of the lipoxygenase gene family and plays a dual role in the synthesis of leukotrienes from arachidonic acid. The encoded protein, which is expressed specifically in bone marrow-derived cells, catalyzes the conversion of arachidonic acid to 5(S)-hydroperoxy-6-trans-8,11,14-cis-eicosatetraenoic acid, and further to the allylic epoxide 5(S)-trans-7,9-trans-11,14-cis-eicosatetrenoic acid (leukotriene A4). Leukotrienes are important mediators of a number of inflammatory and allergic conditions. Mutations in the promoter region of this gene lead to a diminished response to antileukotriene drugs used in the treatment of asthma and may also be associated with atherosclerosis and several cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

ALOX5 Rabbit pAb
A2158-100ul	Abclonal	100 ul	EUR 308

ALOX5 Rabbit pAb
A2158-200ul	Abclonal	200 ul	EUR 459

ALOX5 Rabbit pAb
A2158-20ul	Abclonal	20 ul	EUR 183

ALOX5 Rabbit pAb
A2158-50ul	Abclonal	50 ul	EUR 223

ALOX5 Blocking Peptide
DF6881-BP	Affbiotech	1mg	EUR 195

ALOX5 cloning plasmid
CSB-CL001624HU1-10ug	Cusabio	10ug	EUR 677
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2025 Sequence: atgccctcctacacggtcaccgtggccactggcagccagtggttcgccggcactgacgactacatctacctcagcctcgtgggctcggcgggctgcagcgagaagcacctgctggacaagcccttctacaacgacttcgagcgtggcgcggtggattcatacgacgtgactgtgg Show more
Description: A cloning plasmid for the ALOX5 gene.

ALOX5 cloning plasmid
CSB-CL001624HU2-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2025 Sequence: atgccctcctacacggtcaccgtggccactggcagccagtggttcgccggcactgacgactacatctacctcagcctcgtgggctcggcgggctgcagcgagaagcacctgctggacaagcccttctacaacgacttcgagcgtggcgcggtggattcatacgacgtgactgtgg Show more
Description: A cloning plasmid for the ALOX5 gene.

pDONR223-ALOX5 Plasmid
PVTB01075-1	Lifescience Market	2 ug	EUR 356

5-LOX/ALOX5/ Rat 5- LOX/ ALOX5 ELISA Kit
ELA-E1355r	Lifescience Market	96 Tests	EUR 886

ALOX5 (Phospho-Ser523) Polyclonal Conjugated Antibody
C12128	SAB	100ul	EUR 397

ALOX5 (Phospho-Ser663) Polyclonal Conjugated Antibody
C12671	SAB	100ul	EUR 397

Arachidonate-5-Lipoxygenase (ALOX5) Antibody (Biotin)
20-abx272780	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Arachidonate 5-Lipoxygenase (ALOX5) Antibody (HRP)
20-abx303049	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Arachidonate 5-Lipoxygenase (ALOX5) Antibody (FITC)
20-abx303050	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Arachidonate 5-Lipoxygenase (ALOX5) Antibody (Biotin)
20-abx303051	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ALOX5 Cell ELISA Kit
abx595027-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Rat ALOX5 shRNA Plasmid
20-abx984898	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ALOX5 ELISA Kit
ELA-E1355h	Lifescience Market	96 Tests	EUR 824

ALOX5 ELISA KIT|Human
EF003791	Lifescience Market	96 Tests	EUR 689

Human ALOX5 shRNA Plasmid
20-abx950167	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ALOX5 shRNA Plasmid
20-abx969123	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ALOX5 Recombinant Protein (Human)
RP036568	ABM	100 ug	Ask for price

ALOX5 Recombinant Protein (Human)
RP036571	ABM	100 ug	Ask for price

ALOX5 Recombinant Protein (Rat)
RP189989	ABM	100 ug	Ask for price

ALOX5 Recombinant Protein (Mouse)
RP115469	ABM	100 ug	Ask for price

Mouse ALOX5 ELISA Kit
STJ150547	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of 5-LO in Mouse serum, plasma and other biological fluids

Polyclonal ALOX5 / 5-Lipoxygenase Antibody (aa130-149)
APG01826G	Leading Biology	1 ea	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ALOX5 / 5-Lipoxygenase (aa130-149). This antibody is tested and proven to work in the following applications:

Polyclonal ALOX5 / 5-Lipoxygenase Antibody (aa246-295)
APG01827G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ALOX5 / 5-Lipoxygenase (aa246-295). This antibody is tested and proven to work in the following applications:

Arachidonate-5-Lipoxygenase (ALOX5) Polyclonal Antibody (Human)
4-PAB355Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ALOX5 (Glu461~Ser671) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Arachidonate-5-Lipoxygenase (ALOX5)

Arachidonate-5-Lipoxygenase (ALOX5) Polyclonal Antibody (Mouse)
4-PAB355Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ALOX5 (Leu374~Leu536) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Arachidonate-5-Lipoxygenase (ALOX5)

Arachidonate-5-Lipoxygenase (ALOX5) Polyclonal Antibody (Mouse)
4-PAB355Mu02	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ALOX5 (Val223~Lys410) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Arachidonate-5-Lipoxygenase (ALOX5)

Arachidonate-5-Lipoxygenase (ALOX5) Monoclonal Antibody (Human)
4-MAB355Hu21	Cloud-Clone	EUR 247.00 EUR 2523.00 EUR 628.00 EUR 311.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Glu461~Ser671 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Arachidonate-5-Lipoxygenase (ALOX5)

Phospho-ALOX5 (Ser663) Blocking Peptide
AF8359-BP	Affbiotech	1mg	EUR 195

Phospho-ALOX5-S271 Rabbit pAb
AP0573-100ul	Abclonal	100 ul	EUR 384

Phospho-ALOX5-S271 Rabbit pAb
AP0573-200ul	Abclonal	200 ul	EUR 554

Phospho-ALOX5-S271 Rabbit pAb
AP0573-20ul	Abclonal	20 ul	EUR 183

Phospho-ALOX5-S271 Rabbit pAb
AP0573-50ul	Abclonal	50 ul	EUR 265

Phospho-ALOX5(Ser523) Blocking Peptide
AF0064-BP	Affbiotech	1mg	EUR 195

Alox5 ORF Vector (Mouse) (pORF)
ORF038491	ABM	1.0 ug DNA	EUR 506

ALOX5 ORF Vector (Human) (pORF)
ORF012190	ABM	1.0 ug DNA	EUR 354

ALOX5 ORF Vector (Human) (pORF)
ORF012191	ABM	1.0 ug DNA	EUR 354

Alox5 ORF Vector (Rat) (pORF)
ORF063331	ABM	1.0 ug DNA	EUR 506

Recombinant Arachidonate-5-Lipoxygenase (ALOX5)
4-RPB355Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P16050 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 25.9kDa Isoelectric Point: 5.5
Description: Recombinant Human Arachidonate-5-Lipoxygenase expressed in: E.coli

Recombinant Arachidonate-5-Lipoxygenase (ALOX5)
4-RPB355Mu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P48999 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 20.1kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Arachidonate-5-Lipoxygenase expressed in: E.coli

Recombinant Arachidonate-5-Lipoxygenase (ALOX5)
4-RPB355Mu02	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P48999 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 23.0kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Arachidonate-5-Lipoxygenase expressed in: E.coli

Recombinant Arachidonate-5-Lipoxygenase (ALOX5)
4-RPB355Ra01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P12527 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 20kDa Isoelectric Point: Inquire
Description: Recombinant Rat Arachidonate-5-Lipoxygenase expressed in: E.coli

pECMV-Alox5-m-FLAG Plasmid
PVT14943	Lifescience Market	2 ug	EUR 325

ALOX5 ELISA Kit (Mouse) (OKAN05523)
OKAN05523	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.065 ng/mL

ALOX5 ELISA Kit (Mouse) (OKCD07350)
OKCD07350	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Catalyzes the first step in leukotriene biosynthesis, and thereby plays a role in inflammatory processes.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.065ng/mL

Alox5 ELISA Kit (Rat) (OKEH04835)
OKEH04835	Aviva Systems Biology	96 Wells	EUR 740
Description: Description of target: Catalyzes the conversion of arachidonate to leukotriene A4 in leukotriene metabolism.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.088 ng/mL

Arachidonate-5-Lipoxygenase Phospho-Ser272 (ALOX5 pS272) Antibody
20-abx328185	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Arachidonate-5-Lipoxygenase Phospho-Ser523 (ALOX5 pS523) Antibody
20-abx330124	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Arachidonate-5-Lipoxygenase Phospho-Ser523 (ALOX5 pS523) Antibody
abx333563-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Arachidonate 5-Lipoxygenase Phospho-Ser523 (ALOX5 pS523) Antibody
abx411982-01ml	Abbexa	0.1 ml	EUR 704
Shipped within 1 week.

Arachidonate-5-Lipoxygenase (ALOX5) Polyclonal Antibody (Human), APC
4-PAB355Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ALOX5 (Glu461~Ser671) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Arachidonate-5-Lipoxygenase (ALOX5). This antibody is labeled with APC.

Arachidonate-5-Lipoxygenase (ALOX5) Polyclonal Antibody (Human), Biotinylated
4-PAB355Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ALOX5 (Glu461~Ser671) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Arachidonate-5-Lipoxygenase (ALOX5). This antibody is labeled with Biotin.

Arachidonate-5-Lipoxygenase (ALOX5) Polyclonal Antibody (Human), Cy3
4-PAB355Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ALOX5 (Glu461~Ser671) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Arachidonate-5-Lipoxygenase (ALOX5). This antibody is labeled with Cy3.

Arachidonate-5-Lipoxygenase (ALOX5) Polyclonal Antibody (Human), FITC
4-PAB355Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ALOX5 (Glu461~Ser671) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Arachidonate-5-Lipoxygenase (ALOX5). This antibody is labeled with FITC.

Arachidonate-5-Lipoxygenase (ALOX5) Polyclonal Antibody (Human), HRP
4-PAB355Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ALOX5 (Glu461~Ser671) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Arachidonate-5-Lipoxygenase (ALOX5). This antibody is labeled with HRP.

Arachidonate-5-Lipoxygenase (ALOX5) Polyclonal Antibody (Human), PE
4-PAB355Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ALOX5 (Glu461~Ser671) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Arachidonate-5-Lipoxygenase (ALOX5). This antibody is labeled with PE.

Arachidonate-5-Lipoxygenase (ALOX5) Polyclonal Antibody (Mouse), APC
4-PAB355Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ALOX5 (Leu374~Leu536) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Arachidonate-5-Lipoxygenase (ALOX5). This antibody is labeled with APC.