The Story of Wall Shear Stress in Coronary Artery Atherosclerosis: Biochemical Transport and Mechanotransduction

coronary artery atherosclerosis is, multifactorial, complex disease locally, and a major cause of death in the United States. complex interaction between transport biochemical and biomechanical forces affecting the growth of the disease.

Wall shear stress (WSS) influence coronary artery atherosclerosis by inducing endothelial cell mechanotransduction and by controlling the near-wall transport processes involved in atherosclerosis. Each process is controlled by a different WSS and because it has complicated the interpretation of WSS in atherosclerosis. In this paper, we present a comprehensive theory for WSS in atherosclerosis.

First, a brief review of mechanotransduction shear stress-mediated atherosclerosis is presented. Next, a special subject of computational fluid dynamics (CFD) simulations performed on ten models of coronary artery diseased subjects and healthy. Specific biochemical mass transportation models developed for the study of low-density lipoprotein, nitric oxide, adenosine triphosphate, oxygen, monocyte chemoattractant protein-1, and transportation monocytes.

Results of transport compared to vector WSS and WSS Lagrangian coherent structures (WSS LCS). WSS high magnitude protected against atherosclerosis by increasing production or biochemical flux atheroprotective and reduce localization near-wall biochemistry atherogenic.

The amount of lower WSS promoted atherosclerosis by increasing localization of biochemical atherogenic. Finally, it’s interesting roles WSS SKB more complex where he was promoted or prevented by different biochemical atherosclerosis. We present a summary of the different pathways by which the WSS affect coronary artery atherosclerosis and compare mechanotransduction and biotransport different mechanisms.

Development of volatile organic compounds and their glycosylated precursors in tamarillo (Solanum betaceum Cav.) During fruit ripening: A prediction of biochemical pathways

key metabolites and pathways flavor-regulation in tamarillo investigated to explore the development of a free and glycosylation of volatile organic compounds (VOCs) during fruit ripening. The concentration of VOC-free and bound was determined by analysis by gas chromatography-mass spectrometry. Changes in physical parameters, the concentration of flavor precursors and key endogenous enzyme activity was also monitored.

A total of 22 VOC-free identified with C6 alcohols and esters into the main compound. Of the 83 VOCs detected glycosylation, phenols and terpenoids are the dominant component. The total concentration of VOCs is bound to increase up to four times during the ripening of fruit. Lipoxygenase pathway is confirmed as an important biosynthetic mechanism for the generation of VOC free and glycosylation during maturation tamarillo. This biosynthetic pathway is highly correlated with the activity of key enzymes and content of the substrate, especially of linolenic acid (p <0.05 or p <0.01).

Phenotypic, genotypic and biochemical changes during the selection of pyrethroid resistance in Anopheles gambiae mosquitoes

Directional Selection for insecticide resistance due to the indiscriminate use of insecticides in public health and agriculture system favors increased frequency of insecticide-resistant alleles in natural populations. Similarly, the removal of the selection pressure generally leads to rot in the resistance. recent investigations on the emergence of insecticide resistance in mosquitoes largely rely on field surveys resistance in vector populations that typically have a complex history of exposure to a variety of public health insecticides and pest control agricultural in nature, and thus the effects of certain insecticides on resistance levels level of emergency or resistance to decay unknown.

This study examined the phenotypic, genotypic, and biochemical changes that occur during the selection process for pyrethroid resistance in Anopheles gambiae, the most important vector of malaria in Africa. In parallel, we also examined the changes in the population hold when there is no selection pressure is applied.

Through repeated deltamethrin selection in adult mosquitoes from field populations collected in western Kenya for 12 generations, we obtain three independent and highly pyrethroid resistant An. gambiae populations. Three vulnerable populations from the same parent population is generated by removing the selection pressure.

Second row mosquito populations differ significantly in monooxygenases and beta-esterase activity, but not in Vgsc frequency of gene mutations, suggesting a metabolic detoxification mechanisms play a major role in generating resistance moderate intensity or high intensity resistance. Pre-exposure synergist piperonyl butoxide restored susceptibility to insecticides among highly resistant mosquitoes, confirming the role of monooxygenases in pyrethroid resistance.

The level of damage resistance to be fully susceptible of moderate intensity resistance took 15 generations, to support at least 2-year interval is required when using the rotation of insecticides with different modes of action to be considered for resistance management.

Biochemical parameters in Cognitive Function

cognitive impairment is a common disease. Many studies tried to elucidate the mechanisms of this dysfunction establishment, including the correlation between cognitive function and biochemical parameters. The scientists are looking for substances that will be an indicator of cognitive function and that can be determined in the cerebrospinal fluid or blood from subjects. Until now, they have isolated several such substances; However, research on the specificity of their validity and the possibility of their use in diagnostic and prognostic assessment is still ongoing.

However, there are only a few reports in the literature systematize the existing knowledge about this, and they are mostly associated with Alzheimer’s disease, not cognition in general, or refer only to certain groups of substances. This article discusses the most important biochemical exponent of cognitive function.

GALNT4 Antibody

1-CSB-PA009211GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GALNT4. Recognizes GALNT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti- GALNT4 antibody

FNab03324 100µg
EUR 548.75
  • Immunogen: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4(GalNAc-T4)
  • Uniprot ID: Q8N4A0
  • Gene ID: 8693
  • Research Area: Metabolism
Description: Antibody raised against GALNT4

Anti-GALNT4 antibody

PAab03324 100 ug
EUR 386

Anti-GALNT4 antibody

STJ26586 100 µl
EUR 277
Description: This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. In vitro, the encoded protein can complement other GalNAc-Ts in the complete O-glycosylation of the mucin-1 tandem repeat and can O-glycosylate the P-selectin glycoprotein ligand-1 molecule. The coding region of this gene is contained within a single exon. Fusion transcripts, which combine part of this gene with the 5' exons of the neighboring POC1B (POC1 centriolar protein homolog B) gene, also exist.

GALNT4 siRNA

20-abx917540
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GALNT4 siRNA

20-abx917541
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GALNT4

YF-PA15797 50 ul
EUR 363
Description: Mouse polyclonal to GALNT4

anti-GALNT4

YF-PA15798 100 ug
EUR 403
Description: Rabbit polyclonal to GALNT4

GALNT4 Rabbit pAb

A4243-100ul 100 ul
EUR 308

GALNT4 Rabbit pAb

A4243-200ul 200 ul
EUR 459

GALNT4 Rabbit pAb

A4243-20ul 20 ul Ask for price

GALNT4 Rabbit pAb

A4243-50ul 50 ul Ask for price

GALNT4 Blocking Peptide

33R-1400 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALNT4 antibody, catalog no. 70R-7245

GALNT4 Blocking Peptide

33R-9559 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALNT4 antibody, catalog no. 70R-7248

GALNT4 Blocking Peptide

DF13031-BP 1mg
EUR 195

GALNT4 cloning plasmid

CSB-CL836662HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1737
  • Sequence: atggcggtgaggtggacttgggcaggcaagagctgcctgctgctggcgtttttaacagtggcctatatcttcgtggagctcttggtctctacttttcatgcctccgcaggagccggccgtgccagggagctggggtcaagaaggctctcaggcctccagaaaaatacggaggatt
  • Show more
Description: A cloning plasmid for the GALNT4 gene.

Mouse Galnt4 ELISA KIT

ELI-27156m 96 Tests
EUR 865

GALNT4 ELISA KIT|Human

EF009763 96 Tests
EUR 689

Human GALNT4 ELISA KIT

ELI-30796h 96 Tests
EUR 824

Human GALNT4 shRNA Plasmid

20-abx955721
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GALNT4 shRNA Plasmid

20-abx970459
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GALNT4 Recombinant Protein (Human)

RP012883 100 ug Ask for price

GALNT4 Recombinant Protein (Rat)

RP202175 100 ug Ask for price

GALNT4 Recombinant Protein (Mouse)

RP135836 100 ug Ask for price

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody

20-abx116519
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody

abx122500-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody

20-abx003143
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody

abx036817-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody

abx025629-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody

abx025629-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody

abx233324-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

GALNT4 ORF Vector (Human) (pORF)

ORF004295 1.0 ug DNA
EUR 95

Galnt4 ORF Vector (Rat) (pORF)

ORF067393 1.0 ug DNA
EUR 506

Galnt4 ORF Vector (Mouse) (pORF)

ORF045280 1.0 ug DNA
EUR 506

POC1B-GALNT4 Recombinant Protein (Human)

RP084084 100 ug Ask for price

Galnt4 sgRNA CRISPR Lentivector set (Mouse)

K3418201 3 x 1.0 ug
EUR 339

GALNT4 sgRNA CRISPR Lentivector set (Human)

K0835401 3 x 1.0 ug
EUR 339

Galnt4 sgRNA CRISPR Lentivector set (Rat)

K7515601 3 x 1.0 ug
EUR 339

POC1B-GALNT4 ORF Vector (Human) (pORF)

ORF028029 1.0 ug DNA Ask for price

Galnt4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3418202 1.0 ug DNA
EUR 154

Galnt4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3418203 1.0 ug DNA
EUR 154

Galnt4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3418204 1.0 ug DNA
EUR 154

GALNT4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0835402 1.0 ug DNA
EUR 154

GALNT4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0835403 1.0 ug DNA
EUR 154

GALNT4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0835404 1.0 ug DNA
EUR 154

Galnt4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7515602 1.0 ug DNA
EUR 154

Galnt4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7515603 1.0 ug DNA
EUR 154

Galnt4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7515604 1.0 ug DNA
EUR 154

GALNT4 Protein Vector (Rat) (pPB-C-His)

PV269570 500 ng
EUR 603

GALNT4 Protein Vector (Rat) (pPB-N-His)

PV269571 500 ng
EUR 603

GALNT4 Protein Vector (Rat) (pPM-C-HA)

PV269572 500 ng
EUR 603

GALNT4 Protein Vector (Rat) (pPM-C-His)

PV269573 500 ng
EUR 603

GALNT4 Protein Vector (Mouse) (pPB-C-His)

PV181118 500 ng
EUR 603

GALNT4 Protein Vector (Mouse) (pPB-N-His)

PV181119 500 ng
EUR 603

GALNT4 Protein Vector (Mouse) (pPM-C-HA)

PV181120 500 ng
EUR 603

GALNT4 Protein Vector (Mouse) (pPM-C-His)

PV181121 500 ng
EUR 603

GALNT4 Protein Vector (Human) (pPB-C-His)

PV017177 500 ng
EUR 329

GALNT4 Protein Vector (Human) (pPB-N-His)

PV017178 500 ng
EUR 329

GALNT4 Protein Vector (Human) (pPM-C-HA)

PV017179 500 ng
EUR 329

GALNT4 Protein Vector (Human) (pPM-C-His)

PV017180 500 ng
EUR 329

Galnt4 3'UTR Luciferase Stable Cell Line

TU204930 1.0 ml Ask for price

Galnt4 3'UTR GFP Stable Cell Line

TU156887 1.0 ml Ask for price

GALNT4 3'UTR Luciferase Stable Cell Line

TU008523 1.0 ml
EUR 2333

Galnt4 3'UTR Luciferase Stable Cell Line

TU106887 1.0 ml Ask for price

GALNT4 3'UTR GFP Stable Cell Line

TU058523 1.0 ml
EUR 2333

Galnt4 3'UTR GFP Stable Cell Line

TU254930 1.0 ml Ask for price

Human Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) ELISA Kit

abx387484-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

GALNT4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV638647 1.0 ug DNA
EUR 682

GALNT4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV638651 1.0 ug DNA
EUR 682

GALNT4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV638652 1.0 ug DNA
EUR 682

POC1B-GALNT4 Protein Vector (Human) (pPB-C-His)

PV112114 500 ng Ask for price

POC1B-GALNT4 Protein Vector (Human) (pPB-N-His)

PV112115 500 ng Ask for price

POC1B-GALNT4 Protein Vector (Human) (pPM-C-HA)

PV112116 500 ng Ask for price

POC1B-GALNT4 Protein Vector (Human) (pPM-C-His)

PV112117 500 ng Ask for price

POC1B-GALNT4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV741131 1.0 ug DNA Ask for price

POC1B-GALNT4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV741135 1.0 ug DNA Ask for price

POC1B-GALNT4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV741136 1.0 ug DNA Ask for price

Galnt4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3418205 3 x 1.0 ug
EUR 376

GALNT4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0835405 3 x 1.0 ug
EUR 376

Galnt4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7515605 3 x 1.0 ug
EUR 376

Galnt4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3418206 1.0 ug DNA
EUR 167

Galnt4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3418207 1.0 ug DNA
EUR 167

Galnt4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3418208 1.0 ug DNA
EUR 167

GALNT4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0835406 1.0 ug DNA
EUR 167

GALNT4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0835407 1.0 ug DNA
EUR 167

GALNT4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0835408 1.0 ug DNA
EUR 167

GALNT4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV638648 1.0 ug DNA
EUR 682

GALNT4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV638649 1.0 ug DNA
EUR 740

GALNT4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV638650 1.0 ug DNA
EUR 740

Galnt4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7515606 1.0 ug DNA
EUR 167

Galnt4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7515607 1.0 ug DNA
EUR 167

Galnt4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7515608 1.0 ug DNA
EUR 167

POC1B-GALNT4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV741132 1.0 ug DNA Ask for price

POC1B-GALNT4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV741133 1.0 ug DNA Ask for price

POC1B-GALNT4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV741134 1.0 ug DNA Ask for price

H2B Antibody Antibody

AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug
EUR 438

Ly1 Antibody Reactive (LYAR) Antibody

20-abx123734
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx036399-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx008109
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

20-abx004855
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx014333
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx324434
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319900
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319901
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319905
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319913
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx311665
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx234901-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx230204-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Monoclonal NGF/proNGF Neutralizing Antibody Antibody

AMM06679G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human NGF/proNGF Neutralizing. The antibodies are raised in Mouse. This antibody is applicable in E

Ly1 Antibody Reactive Homolog (LYAR) Antibody

20-abx103034
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody

20-abx103035
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody

20-abx103036
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hepatitis C Virus Antibody (HCV) Antibody

abx023924-1mg 1 mg
EUR 1205
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)

20-abx319902
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)

20-abx319903
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)

20-abx319904
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)

20-abx319906
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)

20-abx319907
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)

20-abx319908
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)

20-abx319914
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)

20-abx319915
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)

20-abx319916
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)

20-abx319929
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)

20-abx319930
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)

20-abx319931
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody (HRP)

20-abx311666
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody (FITC)

20-abx311667
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody (Biotin)

20-abx311668
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leave a Reply

Your email address will not be published. Required fields are marked *